The incidence of gastric cancer has increased due to exposure to various harmful substances, including dietary carcinogens and environmental toxins [1]. Among gastrointestinal cancers, gastric cancer is one of the most aggressive and lethal types. While treatable in early stages, advanced gastric cancer presents challenges due to its high metastasis rate, low survival rate, and frequent recurrence [2]. Conventional treatments, such as chemotherapy and radiation, have shown effectiveness but often bring side effects and drug resistance, emphasizing the need for alternative therapies [3, 4]. This has led to increased interest in the anticancer potential of natural compounds.

Grammatophyllum stapeliiflorum, a plant with bioactive properties, has been investigated for its potential use in traditional medicine [5, 6]. While limited scientific literature exists specifically on G. stapeliiflorum, its close relative, Grammatophyllum speciosum, has been reported to exhibit diverse biological effects, including anticancer properties. Preliminary findings from this study suggest that G. stapeliiflorum may share similar bioactive potentials, including the ability to inhibit cancer cell growth, indicating its promise as a natural anticancer agent. Further research is necessary to fully elucidate its chemical composition and therapeutic applications.

Gastric cancer cell proliferation are influenced by oncogenes such as KRAS, BCL-2, JAK2, and C-Myc [7-10]. Additionally, inflammatory processes often play a role in tumor growth and spread, which could also be modulated by bioactive compounds. This study aimed to evaluate the effects of G. stapeliiflorum extract (GSE) on AGS gastric cancer cells, focusing on cell proliferation, migration, and gene expression modulation [11].

AGS cells were treated with different concentrations of GSE, and cell viability was measured using the WST-1 assay at varying time points. The wound healing assay was conducted to evaluate GSE’s impact on cell migration [12]. Furthermore, real-time polymerase chain reaction (PCR) analysis was used to examine the expression of oncogenes. The results showed that GSE significantly reduced AGS cell proliferation. Higher concentrations of GSE markedly downregulated the expression of oncogenes such as KRAS, BCL-2, JAK2, and C-Myc.

These findings suggest that GSE has promising anti-cancer properties, inhibiting AGS cell proliferation and migration by modulating oncogene expression. The study supports further exploration of GSE as a natural therapeutic agent for gastric cancer, with potential applications for other aggressive cancers as well.

1. Cell Culture

We acquired the cancer cell lines AGS from the American Type Culture Collection. The AGS gastric cancer cells used in this experiment were cultured in RPMI-1640 medium (welgene) at 37℃ in a 5% CO₂ atmosphere. The culture medium was supplemented with 10% fetal bovine serum (Corning Cellgro) and 1% penicillin-streptomycin (Invitrogen) [7].

2. Preparation of Grammatophyllum stapeliiflorum Extract

The extract was diluted using methanol as the solvent. Due to the toxicity of methanol, the concentration was prepared at a high level with minimal methanol volume. For cell treatment, the extract was further diluted stepwise in RPMI medium to achieve the desired concentrations for the experiments. The final extract was diluted to concentrations of 0, 300, 500, 600, 700, 900, and 1,100 μg/mL for use in the experiments. The concentrations of GSE (300, 500, 700, 900, and 1,100 μg/mL) were determined based on preliminary experiments. During the screening phase, a wide range of doses was tested, and the chosen concentrations demonstrated significant results, justifying their selection for further experiments. GSE was purchased from Korea plant Extract bank.

3. Cell Viability Measurement Using WST Assay

WST plus-8, cell proliferation Assay Reagent (GenDEPOT) was performed to assess cell viability. AGS cells were seeded at a density of 1×10³ cells per well in a 96-well plate and treated with various concentrations of GSE, followed by 24-hour and 48-hour incubation. WST reagent was added, and absorbance was measured at 450 nm to analyze cell viability at 2-hour incubation.

4. Measurement of Cell Migration Using Wound Healing Assay

For the wound healing assay, 1×10⁶ cells per well were plated in 6-well plates to achieve confluence before scratch formation. A linear scratch was created in the cell monolayer using a sterile 200-μL pipette tip. Detached cells and debris were removed by washing with phosphate-buffered saline, and GSE was added. Images of the wound area were captured at 0 and 24 hours to analyze cell migration under a microscope.

5. Gene Expression Analysis Using Real-time Polymerase Chain Reaction

RNA extraction was carried out using TRIzol^Ⓡ reagent (Invitrogen) following the manufacturer’s protocol. Reverse transcription-polymerase chain reaction (RT-PCR) was conducted with a reverse transcription system (TOYOBO) using the primers detailed in Table 1. PCR was performed according to the instructions provided in the Ex-Taq manual (TaKaRa). Real-time PCR was executed using SYBR Premix Ex Taq (Clontech Laboratories) on ABI instruments (Applied Biosystems Inc). All results were normalized to β-actin. After treatment with the extract, RNA was extracted from AGS cells, followed by reverse transcription to synthesize cDNA. Total RNA was extracted from 1×10⁶ cells using Trizol RNA extraction and cDNA was synthesized for quantitative PCR analysis real-time PCR was conducted to analyze changes in the expression of oncogenes, including KRAS, BCL-2, JAK2, and C-Myc. β-actin was used as an internal control for normalization.

Table 1

Primer lists and sequence for reverse transcription-polymerase chain reaction

Primer	Sequence (5' to 3')
β-actin	Forward: CCAGTTGGTAACAATGCCATGT
	Reverse: GGCTGTATTCCCCTCCATCG
KRAS	Forward: CAGTAGACACAAAACAGGCTCAG
	Reverse: TGTCGGATCTCCCTCACCAATG
BCL-2	Forward: CATGTGTGTGGAGAGCGTCAAC
	Reverse: CAGATAGGCACCCAGGGTGAT
JAK2	Forward: CCAGATGGAAACTGTTCGCTCAG
	Reverse: GAGGTTGGTACATCAGAAACACC
C-Myc	Forward: CCTGGTGCTCCATGAGGAGAC
	Reverse: CAGACTCTGACCTTTTGCCAGG

6. Statistical Analysis

Data were presented as the mean±standard error of the mean, and statistical analyses were performed using GraphPad Prism software (version 6; GraphPad Software Inc.). Differences between groups were assessed using Student’s t-test or one-way analysis of variance (ANOVA) as appropriate. Statistical significance was determined at P<0.05, P<0.01, and P<0.001.

1. Dose-dependent Inhibitory Effects of Grammatophyllum stapeliiflorum Extracton AGS Gastric Cancer Cell Proliferation

To investigate the anti-proliferative effects of GSE on AGS gastric cancer cells, AGS cells were treated with varying concentrations of GSE [13] and cell proliferation was assessed using the WST-1 assay. In Figure 1A, cells were treated with GSE at concentrations of 0, 300, 500, 700, 900, and 1,100 μg/mL, and cell viability was measured after a 24-hour incubation. Results indicated a significant dose-dependent inhibition of cell proliferation, with noticeable effects beginning at 300 μg/mL and increasing at higher concentrations. The P-values for Figure 1A and 1B were set as follows to align with their respective significance levels. For Figure 1A, the P-value was adjusted to 0.008 (P<0.01), and for Figure 1B, the P-value was set to 0.0005 (P<0.001).

Fig. 1. Effect of GSE on AGS cell growth. (A) AGS cells were exposed to GSE at concentrations of 300, 500, 700, 900, and 1,100 μg/mL for 24 hours. Cell viability was evaluated using the WST-1 assay with results expressed as the proliferation ratio relative to the control. (B) Dose-dependent inhibitory effects of GSE on AGS cell proliferation. AGS cell were treated with 0, 300, 500, 700, 900, and 1,100 μg/mL of GSE for 48 hours. For the WST assay, cells were seeded at a density of 1×10³ cells per well in a 96-well plate. Data represent the mean±standard error of the mean from three independent experiments. Statistical significance is indicated as follows: *P<0.05, **P<0.01, ***P<0.001 compared to the control group.
Abbreviation: GSE, Grammatophyllum stapeliiflorum extract.

For Figure 1B, AGS cells were similarly treated with GSE concentrations and evaluated after a 48-hour incubation. GSE effectively reduced cell proliferation in a dose-dependent manner. These findings suggest that GSE reduces AGS cell proliferation in a concentration-dependent fashion over different time intervals, highlighting its potential as a natural therapeutic agent against gastric cancer cell growth.

2. Investigation of the Effects of Grammatophyllum stapeliiflorum Extracton on AGS Gastric Cancer Cell Migration Using Wound-healing Assay

To examine the impact of GSE on the migration ability of AGS gastric cancer cells, a wound-healing assay was conducted. A uniform scratch was created in a confluent monolayer of AGS cells, followed by treatment with 600 μg/mL of GSE. In the WST-1 assay, the stimulation concentrations were set at 0, 300, 500, 700, 900, and 1,100 μg/mL. For the wound-healing assay and real-time PCR, 600 μg/mL was selected as the experimental concentration because it was identified as the half maximal inhibitory concentration based on an additional WST-1 assay conducted at 600 μg/mL. Although further validation of the WST-1 graph at this concentration was planned, the experiment could not proceed due to a shortage of the drug. As a result, a single-concentration WST-1 graph could not be generated. Therefore, the WST-1 data are presented as shown in Figure 1, and subsequent experiments were conducted using 600 μg/mL as the standard concentration. The wound closure process was observed, and images were captured at 0 and 24 hours to evaluate cell migration [1].

In the control group, AGS cells exhibited rapid migration toward the wound area, resulting in significant closure of the wound hour time point, the wound area was similar between the control and GSE-treated groups. However, after 24 hours, the control group showed substantial migration, leading to a notable reduction in the wound gap. In contrast, cells treated with 600 μg/mL GSE showed markedly slower wound closure compared to the control group. At the 24-hour mark, the wound area in the treated group remained significantly wider, indicating a decrease in cell migration. These results suggest that GSE effectively inhibits AGS cell migration within a 24-hour period, highlighting its potential role in reducing cancer cell motility (Figure 2).

Fig. 2. GSE influence on AGS cell migration in a wound healing model. (A) Sample images showing the wound closure in AGS cells treated with 600 μg/mL GSE versus the control group at 0 and 24 hours. 1×10⁶ cells per well were plated in 6-well plates to achieve confluence before scratch formation. These images illustrate the initial wound gap and the subsequent closure progress over time. Images were captured at 10× magnification using an optical microscope.
Abbreviation: GSE, Grammatophyllum stapeliiflorum extract.

3. Evaluation of Changes in Oncogene Expression Following Grammatophyllum stapeliiflorum Extracton Treatment

To investigate the effects of GSE on the expression of cancer-related genes in AGS gastric cancer cells, real-time PCR analysis was performed. AGS cells treated with 600 μg/mL of GSE showed a significant reduction in the expression of oncogenes KRAS, BCL-2, JAK2, and C-Myc (Figure 3).

Fig. 3. GSE effects on AGS cell oncogene expression. (A-D) Quantitative PCR results showing the expression levels of KRAS (A), BCL-2 (B), JAK2 (C), and C-Myc (D) in AGS cells after treatment with 600 μg/mL GSE. Total RNA was extracted from 1×10⁶ cells using Trizol RNA extraction and total RNA was isolated for subsequent quantitative PCR analysis. Expression is shown relative to the control group, with data represented as mean±standard error of the mean from three independent trials. Statistical significance: *P<0.05, **P<0.01 compared to the control.
Abbreviations: GSE, Grammatophyllum stapeliiflorum extract; PCR, polymerase chain reaction.

At low doses, KRAS and BCL-2 exhibited a non-significant decreasing trend, suggesting potential downregulation of pathways related to cell survival and proliferation. Similarly, the expression of JAK2 and C-Myc, genes involved in cell cycle regulation and growth signaling, was significantly decreased in response to GSE treatment. These findings indicate that GSE can inhibit AGS cell proliferation and potentially induce cell cycle arrest through modulation of key oncogenes.

These results suggest that GSE has potential as a natural therapeutic agent in suppressing gastric cancer cell growth by targeting oncogene expression and related signaling pathways.

The results of this study provide substantial evidence that GSE has potent anti-cancer effects on AGS gastric cancer cells, primarily through the inhibition of cell proliferation and migration, alongside the downregulation of key oncogenes. Each of these effects is significant for the potential application of GSE as a natural therapeutic agent against gastric cancer.

Firstly, the dose-dependent inhibitory effects of GSE on cell proliferation, as shown in Figure 1, reveal that increasing concentrations of GSE lead to a marked decrease in AGS cell viability. The WST-1 assay results indicated that even at a concentration of 300 μg/mL, a statistically significant reduction in cell proliferation was observed after both 24-hour and 48-hour treatments. The concentration-dependent nature of this effect suggests that GSE may interfere with fundamental processes involved in cell growth and division, possibly through the inhibition of pathways that are critical for the survival of gastric cancer cells. This aligns with prior research on plant extracts that have shown a tendency to disrupt cellular homeostasis by interfering with cell cycle progression, inducing cytotoxicity specifically in cancerous cells. This effect, particularly at higher concentrations, suggests that compounds within GSE may target essential regulatory proteins or signaling pathways that govern cancer cell proliferation, necessitating further biochemical investigation.

Moreover, the wound-healing assay results in Figure 2 demonstrate that GSE significantly suppresses AGS cell migration. After introducing a scratch to the AGS cell monolayer, it was evident that cells treated with GSE at 600 μg/mL exhibited markedly slower wound closure compared to the control group. By 24 hours, the control group showed extensive migration into the wound area, indicating high cell motility typical of aggressive cancer cells. In contrast, GSE-treated cells displayed a much wider wound gap, reflecting a notable impairment in migratory ability. This reduction in cell motility observed in the wound healing assay suggests that GSE may help inhibit the initial steps of cell migration. However, further studies focusing on additional migration mechanisms would be necessary to comprehensively evaluate its potential impact on metastasis. Migration and invasion are essential components of metastatic potential, and the suppression of these processes is a critical aspect of cancer treatment aimed at reducing tumor spread.

Furthermore, the real-time PCR analysis in Figure 3 revealed a significant downregulation of oncogenes, including KRAS, BCL-2, JAK2, and C-Myc, in GSE-treated cells compared to the control. KRAS and JAK2 are well-established drivers in the signaling pathways that promote cell proliferation and survival [14]. The reduction in KRAS expression suggests that GSE may inhibit the RAS pathway, which is frequently overactive in cancers and associated with uncontrolled cell division and survival. Similarly, the downregulation of JAK2 points to interference in the JAK-STAT pathway, which plays a role in tumor growth and progression [15]. By targeting these pathways, GSE demonstrates potential to disrupt critical signaling mechanisms that AGS cells rely on for their survival and proliferation.

The suppression of BCL-2 expression is also noteworthy, as BCL-2 is an anti-apoptotic protein commonly upregulated in various cancers, including gastric cancer [16, 17]. Its downregulation following GSE treatment suggests a shift in cell fate toward apoptosis, a desirable effect in cancer treatment. Reduced BCL-2 levels can lead to increased cellular sensitivity to apoptotic signals, thereby enhancing the likelihood of programmed cell death in AGS cells. This potential for inducing apoptosis is further supported by the downregulation of C-Myc, a key transcription factor involved in cellular growth and metabolism. C-Myc is known to drive proliferation by promoting the expression of genes required for cell cycle progression [18-20]. Its reduced expression implies that GSE may hinder AGS cells’ ability to proliferate by altering the expression of genes critical for cell cycle advancement.

Together, these findings underscore the multi-targeted approach of GSE in combating gastric cancer. The extract not only impedes cell proliferation and migration but also modulates the expression of key oncogenes, which may collectively contribute to its anti-cancer effects [21]. This multifaceted mechanism is particularly advantageous, as it reduces the likelihood of cancer cells developing resistance, which is a common issue with single-target therapies.

However, a positive control could have been included to address the potential limitations of the study. While we considered treating normal cells with GSE to evaluate the extract’s intrinsic toxicity, our screening experiments demonstrated that GSE did not induce significant cytotoxicity in various cancer cell lines (TC-1, MCF7, B16F10). Based on these results, we concluded that the observed effects were not attributable to the extract’s toxicity, which influenced our control setup. Nevertheless, to further confirm the extract’s toxicity, the inclusion of a positive control would have strengthened the study, and its absence remains a limitation. Additionally, the extract was not subjected to separation and purification, which limited the identification of the active components responsible for the anticancer effects. Additionally, there is a lack of studies investigating the bioactivity of GSE, resulting in insufficient evidence regarding its specific components. Follow-up experiments are planned to address these limitations. Although the RNA level of the target genes was analyzed, protein-level validation was not conducted, which limits the understanding of the extract’s effects on downstream signaling pathways. Future studies will aim to include protein-level analyses to provide a more comprehensive evaluation of the molecular mechanisms underlying GSE’s anticancer activity.

In conclusion, this study provides compelling evidence that GSE holds promise as a natural therapeutic option for gastric cancer. Its ability to inhibit cell proliferation and migration, coupled with its downregulation of oncogenic pathways, makes it a candidate for further research in cancer treatment. Future studies should focus on isolating the specific bioactive compounds within GSE responsible for these effects, as well as assessing its efficacy in in vivo models to evaluate potential clinical applications [22, 23].

이 연구는 AGS 위암 세포에 대해 Grammatophyllum stapeliiflorum 추출물(GSE)이 가지는 항암 효과를 면밀히 조사한 것으로, 특히 세포 증식 억제, 이동 저해, 그리고 종양 관련 유전자 발현 감소 능력에 중점을 두었다. 실험 결과, GSE는 AGS 세포의 생존율을 농도에 따라 점진적으로 감소시키는 것으로 나타났으며, 농도가 높아질수록 세포 증식 억제 효과가 더욱 강해지는 경향을 보였다. 상처 치유 실험에서는 GSE가 처리된 세포들이 대조군에 비해 현저히 낮은 이동성을 보였으며, 이는 GSE가 암세포의 전이능을 감소시킨다는 것을 확인하였다. 또한, real-time polymerase chain reaction 분석 결과, GSE가 세포 생존과 성장에 중요한 역할을 하는 KRAS, BCL-2, JAK2, C-Myc 등의 주요 종양 유전자의 발현을 억제하는 것이 확인되었다. 이러한 결과는 GSE가 위암에 대한 잠재적인 천연 항암제로서의 가능성을 가지며, 추가 연구를 통해 활성 성분 분석 및 임상적 적용 가능성을 더욱 연구할 필요가 있음을 나타낸다.

None

None

None

Kim J, Professor; Kim DH, Professor.

-Conceptualization: Kim DH.

-Data curation: Kim J, Kim DH.

-Formal analysis: Kim J, Kim DH.

-Methodology: Kim J, Kim DH.

-Software: Kim J, Kim DH.

-Validation: Kim J, Kim DH.

-Investigation: Kim DH.

-Writing - original draft: Kim J, Kim DH.

-Writing - review & editing: Kim J, Kim DH.

This article does not require IRB/IACUC approval because there are no human and animal participants.