Skeletal muscle, the most abundant tissue in the body, is essential for movement, posture maintenance, and heat generation. It also significantly contributes to energy metabolism via uptake regulation and utilization of key nutrients such as glucose and fatty acids. [1]. Several pathological conditions, including nerve injury, disuse, cachexia, aging, drug toxicity, and heart failure, can disrupt the balance between muscle protein synthe-sis and breakdown. This imbalance often results in skeletal muscle atrophy, characterized by the progressive loss of skeletal muscle mass and function [2]. Skeletal muscle atrophy severely affects quality of life and contributes to metabolic abnormalities such as insulin resistance and type 2 diabetes, potentially increasing morbidity and mortality risks [3]. Therefore, main-taining healthy skeletal muscles is crucial for maintaining overall health.

Skeletal muscle differentiation, called myogenesis, is a highly ordered multiphase process from myoblast proliferation to fusion and multinucleated myotube formation [4]. The C2C12 cell line, derived from murine myoblasts, effectively mimics the process of skeletal muscle differentiation in vitro and provides an optimal cellular system for investigating the mechanisms under-lying myogenic differentiation [5]. Myogenesis is governed by the sequential expression of myogenic regulatory factors (MRFs). MRFs, including myoblast determination protein 1 (MyoD), myogenic factor 5 (Myf-5), myogenin, and MRF4, belong to a set of basic helix-loop-helix transcription factors [6]. When introduced into various non-muscle cells in culture, each of the four MRFs is capable of predominantly inducing myogenesis. However, this function requires the activity of other myogenic transcription factors, such as myocyte enhancer factor 2 (MEF2). MEF2 factors are essential for muscle differentiation, and MRFs and MEF2 collaboratively activate transcription and myogenesis [7]. At the onset of differentiation, myoblasts proliferate and subsequently express Myf5 and MyoD [8]. These factors stimulate myoblasts to initiate differentiation, followed by myogenin and MRF4 expression [9]. Myogenin and MRF4 facilitate cell fusion, leading to the withdrawal of myoblasts from the cell cycle. Once differentiation reaches the late stage, terminal differentiation markers and structural proteins, such as muscle creatine kinase (MCK) and myosin heavy chain (MyHC), increase. The degree of muscle differen-tiation was verified by measuring the myogenic factor expression. Finally, after the differentiation is completed, muscle size is enhanced through muscle hypertrophy, a process during which the diameter and length of the fused myotubes increase in the protein synthesis pathway [10].

Protein kinase B (Akt), a serine-threonine kinase, is crucial for promoting muscle hypertrophy by regulating protein synthesis. The activation of Akt prevents dener-vation-induced atrophy, whereas a decrease in its expression and activity is associated with progressive muscular atrophy in animal models [11, 12]. Active Akt can phosphorylate forkhead box proteins, thus inhibiting them from promoting the transcription of atrophy-related genes such as atrogin-1 and muscle ring fnger-1 (MuRF-1). These genes, E3-ubiquitin ligases, contribute to muscle loss [13]. Therefore, decreased Akt activity can upregulate the atrophy-associated protein expressions, thereby enhancing muscle degradation processes.

Anise (Pimpinella anisum) is a flowering plant with highly fragrant seeds that belongs to the Umbelliferae family and is native to the eastern Mediterranean region and Southwest Asia. In the Mediterranean and Southwest Asian folk medicine, anise, especially its seeds, has been commonly utilized as an appetizer, tranquilizer, diuretic, carminative, galactogogue, and disinfectant drug [14]. Phytochemical studies indicate that anise essential oils contain numerous active ingredients that exert antiviral, antibacterial, antioxidant, anticarcinogenic, and antifungal activities [14]. p-anisaldehyde (PAA; also known as 4-methoxy benzaldehyde), the main component found in anise seed-derived essential oils and structurally related to vanillin, is one of the primary flavoring compounds worldwide [15]. PAA exhibits antimicrobial activity against several foodborne bacteria, yeast, and mold strains in laboratory settings and in fruit purees and juices [15]. It also effectively preserves fruit quality by inhibiting fungal growth and enhancing antioxidant activity [16]. However, there are no reports on the effects of PAA on skeletal muscle differentiation.

Therefore, we investigated the effects of PAA on the differentiation of C2C12 myoblasts. We demonstrated that PAA suppressed C2C12 myoblast differentiation. The effect of PAA on C2C12 cells was mediated by the upregulation of expression of the muscle atrophy genes atrogin-1 and MuRF-1 and downregulation of phosphory-lation of the promyogenic kinase Akt. Our study provides valuable insights into the impact of PAA on individuals at risk of muscle atrophy.

1. Reagents

PAA was purchased from ChromaDex Inc., dissolved in ethanol to generate 100 mg/mL stock solution, and stored at ‒20℃ until use (dilutions were made in culture medium). Dulbecco's modified Eagle medium (DMEM) was purchased from Welgene Inc.. Horse serum and TRIzol were purchased from Invitrogen. Fetal bovine serum and penicillin/streptomycin (P/S) were pur-chased from GE Healthcare Life Sciences Co. 3-(4,5-Dimethylthiazol-2-yl)-2,5-dipheny tetrazolium bromide (MTT) and lactate dehydrogenase (LDH) were purchased from Promega Corp. A cDNA synthesis kit was obtained from Enzynomics Inc. SYBR Green Master Mix Reagent, Radioimmunoprecipitation assay buffer, proteinase inhibitor, phosphatase inhibitor, and goat anti-rabbit immunoglobulin secondary antibodies were purchased from GenDEPOT Co. Bicinchoninic acid assay (BCA) Protein assay reagent and polyvinylidene fluoride (PVDF) were purchased from Pierce Distribution Services Company, Inc. and Bio Rad Laboratories, respec-tively. Antibodies against phosphorylated (p-)Akt (Ser473; #4060) and Akt1/2/3 (#9272) were purchased from Cell Signaling Technology Inc.

2. Cell Culture and Maintenance

Murine C2C12 myoblasts were purchased from American Type Culture Collection (ATCC CRL-1772). The myoblasts were cultured in growth medium (GM) containing high-glucose DMEM supplemented with 10% fetal bovine serum and 1% P/S in a 5% CO₂ humidified atmosphere at 37℃. Cells were sub-cultured until they reached 70% confluency.

3. Induction of Myogenic Differentiation and Treatment

Myoblasts were plated in 6-well plates containing GM. When the cells reached 80%~90% confluency, the GM was replaced by differentiation medium (DM) com-posed of high-glucose DMEM, 2% horse serum, and 1% P/S, with or without 50 or 200 μg of PAA to promote fusion into myotubes. Fresh DM with or without PAA was changed daily for 24 h (DM1), 72 h (DM3) or 120 h (DM5).

4. Measurement of Cell Viability and Death

Cell viability was determined using the MTT assay. The myoblasts were seeded in 6-well plates containing DM, with or without PAA (0, 25, 50, 100, 200, and 400 μg) for 1 or 3 days. Media were then collected for the LDH assay, and the cells were incubated with fresh medium containing the MTT reagent (0.5 mg/mL) at 37℃ for 2 h. Formazan was dissolved in dimethyl sulfoxide, and the absorbance at 490 nm was measured using an enzyme-linked immunosorbent assay plate reader (Molecular Devices LLC.).

Cell death was determined by measuring the amount of LDH released into the medium. The medium was collected and immediately stored at ‒80℃. LDH activity in the collected medium was measured in duplicate according to the manufacturer’s instructions.

5. Cell Morphology Monitoring

The cell morphology was observed under a phase-contrast microscope (Leica DM IL; Leica Microsystems) at 100× magnification before RNA or protein extraction. The length and diameter of the 50 largest myotubes were measured from 10 random fields using ImageJ software (National Institutes of Health [NIH]).

6. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction Analysis

Total RNA was extracted from the cells using the TRIzol reagent. cDNA was synthesized from 1 μg of total RNA using the TOPscript^TM RT DryMIX cDNA synthesis kit according to the manufacturer’s instructions. Quan-titative real-time polymerase chain reaction (qRT-PCR) was performed with the SYBR Green PCR master mix using the Quantstudio3 Real-Time PCR System (Applied Biosystems). All reactions were run in triplicate, and the PCR product size was verified using melting curve analysis. The PCR conditions were as follows: 95℃ for 3 min, followed by 40 cycles of 95℃ for 3 s and 60℃ for 30 s. Relative mRNA expression values were normalized to the level of β-Actin expression. The primers designed for amplification were listed in Table 1 [17-20].

Table 1

Primer sequences used for gene expression analysis by quantitative real-time polymerase chain reaction

Gene	Direction	Sequences (5'→3')	References
MyoD	Forward	ACTTTCTGGAGCCCTCCTGGCA	[17]
	Reverse	TTTGTTGCACTACACAGCATG	[17]
Myogenin	Forward	CTTGCTCAGCTCCCTCAACC	[18]
	Reverse	GTTGGGACCGAACTCCAGTG	[18]
MEF2C	Forward	TGATCAGCAGGCAAAGATTG	[18]
	Reverse	ATCAGACCGCCTGTGTTACC	[18]
MCK	Forward	CTTCATGTGGAACGAGCACCTG	[17]
	Reverse	GCGTTGGAGATGTCGAACACG	[17]
MyHC	Forward	AGGGAGCTTGAAAACGAGGT	[17]
	Reverse	GCTTCCTCCAGCTCGTGCTG	[17]
MuRF-1	Forward	GGAACCTGCTGGTGGAAAACATC	[19]
	Reverse	CGTCTTCGTGTTCCTTGCACATC	[19]
Atrogin-1	Forward	GCAGAGAGTCGGCAAGTC	[19]
	Reverse	CAGGTCGGTGATCGTGAG	[19]
β-actin	Forward	ACGGCCAGGTCATCACTATTG	[20]
	Reverse	CACAGGATTCCATACCCAAGAAG	[20]

Abbreviations: MyoD, myoblast determination protein 1; MEF2C, myocyte enhancer factor 2C; MCK, muscle creatine kinase; MyHC, myosin heavy chain; MuRF-1, muscle ring finger-1.

7. Western Blotting

Myoblasts and differentiated myotubes were washed with phosphate-buffered saline and extracted using a lysis buffer containing protease and phosphatase inhi-bitors. Following centrifugation (14,000×g) at 4℃ for 15 min, the supernatant was collected and the protein concentration was determined using BCA protein assay reagent. Equal amounts (15 μg) of cell protein extracts were resolved using sodium dodecyl sulfate polyacrylamide gel electrophoresis. Resolved proteins were electrophoretically transferred to PVDF membranes and blocked in 5% nonfat milk containing 150 mM NaCl, 0.05% Tween-20, and 20 mM Tris-HCl, pH 7.4 (Tris-buffered saline with Tween 20 buffer) for 1 h at room temperature. After blocking, the membranes were incu-bated overnight with primary antibodies (1:1,000). The membranes were washed and incubated for 1 h at room temperature with a goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:5,000), followed by detection using an enhanced chemilumine-scence system. Densitometric analyses were performed using the ImageJ software (NIH).

8. Statistical Analysis

Results were expressed as mean±SD. Data were analyzed by unpaired two-tailed Student’s t-test using Prism 5 (GraphPad). The means of two groups were considered significantly different at P<0.05. Cell culture experiments were performed in triplicates.

1. Effects of p-anisaldehyde on Viability and Cytotoxicity in C2C12 Cells

To investigate PAA effects on myogenic differen-tiation, murine C2C12 cells were analyzed as described in the Materials and Methods section and illustrated in Figure 1. We examined the effects of PAA on cell viability and cytotoxicity using the MTT and LDH assays, respectively. C2C12 cells cultured in the DM were treated with various concentrations of PAA (0, 25, 50, 100, 200, and 400 μg) for 1 or 3 days. As shown in Figure 2, PAA did not affect the viability or cytotoxicity of C2C12 cells at any of the concentrations used in this study. Thus, we used two concentrations of PAA, 50 and 200 μg, in further studies to assess the effect on the differentiation of C2C12 myoblasts.

Fig. 1. C2C12 differentiation time course. C2C12 myocytes were plated in growth medium (GM) until 80%~90% confluence and then grown in differentiation medium (DM) with or without 50 or 200 μg of p-anisaldehyde. Culture samples were analyzed for the morphologic and molecular phenotype studies from four time points: GM, day 1 (DM1), day 3 (DM3), and day 5 (DM5).

Fig. 2. Effect of p-anisaldehyde (PAA) on cell viability (MTT) and cytotoxicity (LDH) in C2C12 cells. C2C12 cells were treated with differentiation medium containing PAA in a dose-dependent manner (0, 25, 50, 100, 200, and 400 μg). (A) MTT and (B) LDH assays were conducted 1 and 3 days after the treatments to determine cell viability and cellular toxicity, respectively. The experiment was repeated three times. Results are expressed as mean±SD and percentage of the untreated controls.

2. p-anisaldehyde Suppresses the Morphological Change of C2C12 Myoblasts Differentiating into Myotubes

To evaluate PAA effect on myogenic differentiation, we examined the morphological change in C2C12 cells. C2C12 myoblasts cultured in GM were subsequently cultured in DM in the presence or absence of 50 or 200 μg PAA. During C2C12 development from day 0 to 5, a marked dose-dependent reduction in the ability to form myotubes was observed in the PAA-treated cells (Figure 3A). Moreover, the length and diameter of C2C12 myotubes were measured from morphology images at the end of culture, and C2C12 cells treated with PAA displayed smaller and thinner myotubes than untreated cells (Figure 3B, 3C). These data suggest that PAA has an atrophic effect on the myogenic differen-tiation of C2C12 cells.

Fig. 3. Effects of p-anisaldehyde (PAA) on C2C12 myoblast differentiation. C2C12 cells were cultured in differentiation medium (DM) to induce differentiation and were treated with or without 50 or 200 μg of PAA for 5 days. (A) Phase-contrast images of cell morphology were obtained at the indicated time points. Scale bar, 100 μm. (B) Myotube length and (C) diameter were quantified at the end of the experiment (5th day). Results are expressed as mean±SD. *P<0.01, ***P<0.001 compared with the untreated controls.
Abbreviation: GM, growth medium.

3. p-anisaldehyde Decreases the Expression of Myogenic Markers during Myoblast Differentiation

As changes in cell morphology in response to myogenic differentiation were affected by PAA, we tested the effects of PAA on the expression of myogenic markers. The C2C12 cells were cultured in GM until they reached 80%~90% confluence, the medium was then switched to DM, and the cells treated with or without 50 or 200 μg PAA. The cells were then harvested after 1, 3, and 5 days of differentiation to measure the expression levels of myogenic genes, including MyoD, myogenin, MEF2C, MCK, and MyHC. qRT-PCR analysis showed that PAA treatment significantly suppressed the mRNA levels of these genes in a concentration-dependent manner compared with those in C2C12 control cells (Figure 4). These results suggest that PAA-induced transcriptional changes may underlie PAA-induced inhibition of myogenic differentiation.

Fig. 4. Effects of p-anisaldehyde (PAA) on myogenic genes expression. C2C12 cells were cultured in differentiation medium (DM) and were treated with or without 50 or 200 μg. The cells were harvested on differentiation days 1, 3, and 5. Quantitative real-time polymerase chain reaction was performed to assess the expression of MyoD, myogenin, MEF2C, MCK, and MyHC during myoblast differentiation. Results are expressed as mean±SD. *P<0.05, **P<0.01, ***P<0.001 compared with the untreated controls.
Abbreviations: MyoD, myoblast determination protein 1; MEF2C, myocyte enhancer factor 2C; MCK, muscle creatine kinase; MyHC, myosin heavy chain; GM, growth medium.

4. p-anisaldehyde Upregulates Atrophy-Related Genes by Inhibiting Protein Kinase B Phosphorylation

Akt plays a critical role in regulating the balance between hypertrophy and atrophy [11, 12] and regulates the expression of the muscle-specific genes MyoD, myogenin, MEF2C, MCK, and MyHC as myogenic markers [21]. Therefore, we determined whether PAA modulates Akt activation in C2C12 cells. To determine the effect of PAA on Akt activation, cells were treated with or without 50 or 200 μg PAA and harvested after 1, 3, and 5 days of differentiation. Treatments of C2C12 cells with PAA resulted in the effective downregulation of p-Akt, and total AKT was used as a loading control (Figure 5A, 5B). Subsequently, we measured the mRNA expression of atrogin-1 and MuRF-1, which are atrophic markers whose upregulation is promoted by the downregulation of Akt activity and induction of protein degradation [13]. PAA treatment increased atrogin-1 and MuRF-1 expressions dose-dependently (Figure 5C). These observations demonstrate that PAA promotes muscle atrophy by reducing Akt phosphorylation and activation in C2C12 cells.

Fig. 5. Effect of p-anisaldehyde (PAA) on protein kinase B (Akt)-mediated proteolysis in the differentiation of C2C12 cells. C2C12 cells were cultured in differentiation medium (DM) with or without 50 or 200 μg and were harvested on days 1, 3, and 5 of differentiation. (A, B) Protein expression levels of Akt and p-Akt were analyzed using western blot analysis, and representative images of the protein band are shown in the top panel. Band intensities were quantitated using computerized densitometry and are shown in the bottom panel. The values were normalized to those of total Akt, and the fold change relative to untreated cells is presented. (C) Atrogin-1 and muscle ring finger-1 (MuRF-1) expression were analyzed using quantitative real-time polymerase chain reaction during myoblast differentiation. Results are expressed as mean±SD. *P<0.05, **P<0.01,***P<0.001 compared with the untreated controls.
Abbreviation: GM, growth medium.

This study aimed to identify the differentiation of C2C12 muscle cells using PAA, a major component of the essential oil from anise seed. We demonstrated that PAA adversely affects muscle differentiation by inducing muscle atrophy by suppressing Akt phosphorylation and activation. Despite previous studies demonstrating that anise seeds, their essential oil, and the components derived from the essential oil possess various therapeutic effects [14], there is virtually no known information regarding their role in muscle health. This is the first study to elucidate the role of a substance derived from anise seeds on myogenesis.

Essential oils, volatile aromatic compounds extracted from various plant parts, have been used as comple-mentary and alternative therapies in ancient civiliza-tions, such as Egypt, China, and India, for at least 6,000 years. These oils possess numerous pharmacological properties, including anti-inflammatory, antinociceptive, antibacterial, antifungal, and antioxidant properties [22]. They have been widely used in inhalation aromatherapy, alleviating various mental symptoms, such as stress, anxiety, and depression [23]. Furthermore, they have been applied in diverse therapeutic contexts to address several conditions, including sleep disorders, Alzheimer's disease, cardiovascular complications, and cancer [24]. Since essential oils are generally natural and pure products, they are often considered safer alternatives to synthetic compounds. In addition, they can be readily purchased and are typically cost-effective. Thus, essential oils are considered promising agents, that pave way for innovative therapies to reduce side effects and the high costs of treating various diseases. However, clinical trials have revealed mild-to-severe adverse effects of essential oils, including allergies, dermatitis, neurotoxicity, intoxication, and fatality [25], suggesting that it is crucial to identify essential oils that provide health benefits while minimizing side effects.

Approximately 20 active ingredients have been iden-tified in the essential oil from anise seeds, among which the predominant volatile compounds are trans-anethole (76.9%~93.7%), gamma-himachalene (0.4%~8.2%), trans-pseudoisoeugenyl 2-methylbutyrate (0.4%~6.4%), p-anisaldehyde (5.4%) and methylchavicol (0.5%~2.3%) [26]. Therefore, the amount of PAA contained in the anise oil was low. There are no reported side effects of regular anise consumption, suggesting that it may be a promising candidate in natural product-based therapies. In this study, we demonstrated that PAA induced muscle atrophy when it was used for muscle cell differen-tiation. This suggests that using large quantities of anise may induce muscle atrophy as a side effect due to its increased PAA content. However, in contexts such as rhabdomyosarcoma treatment, muscle regeneration therapy, stem cell research, and certain genetic disorders, inhibiting muscle differentiation may be advantageous. Thus, PAA could be beneficial when utilized as a therapeutic component in these scenarios [27-29].

Skeletal muscle atrophy is characterized by progressive muscle mass and strength loss that reduces the quality of life [30], and decreased myotube diameter is the most prominent histopathological characteristic of this disease. This condition can be caused by age-related sarcopenia, cachexia from cancer, chronic obstructive pulmonary disorder, diabetes, obesity, chronic kidney disease, heart failure, neurodegenerative disorders, sepsis, burns, and trauma [30]. The treatment strategies for skeletal muscle atrophy include physical exercise, nutritional supplements, and medications. However, no therapeutic drugs have been successfully marketed, and no effective cure for skeletal muscle atrophy has been developed. The fundamental molecular mechanisms involved in skeletal muscle atrophy include the ubiquitin-proteasome system, autophagy, inflam-mation, insulin-like growth factor 1/PI3K/Akt signaling pathway, and myostatin pathway [2]. Our findings suggest that PAA is associated with activating the ubiquitin-proteasome pathway, particularly the ubiquitin ligases atrogin-1 and MuRF-1, due to decreased Akt activity. However, further studies are necessary to determine whether PAA affects other pathogenic mechanisms of muscle atrophy.

In summary, we have identified PAA as a potent inducer of muscle atrophy. It inhibits skeletal muscle myoblast differentiation by downregulating the expression of myogenic genes and upregulating muscle atrophy-associated ubiquitin ligases, including atrogin-1 and MuRF-1, via Akt-dependent regulation. Our work suggests that that using large quantities of anise essential oil or any essential oil containing PAA can result in muscle atrophy as a side effect. This indicates that individuals at risk of muscle atrophy should exercise caution when using anise essential oils or essential oils containing PAA.

골격근은 대사, 열기반 온도 조절, 그리고 전반적인 체내 균형을 위해 필수적인 조직이고 근발생(myogenesis)이라는 다단계 과정을 거쳐서 근관세포를 형성한다. p-아니스알데하이드(p-anisaldehyde, PAA) (4-메톡시벤잘데하이드)는 아니스 씨에서 추출된 에센셜 오일의 주성분이지만, 골격근에서의 기능은 아직까지 알려져 있지 않다. 따라서, 우리는 마우스 C2C12 근육모세포를 이용하여 근육분화가 PAA에 의해 영향을 받는지를 연구하였다. C2C12 근육모세포의 분화를 유도하기 위해 이 세포를 분화배지에서 5일동안 배양하였고, 매일 PAA (50 또는 200 μg/mL)를 포함하는 새로운 배지로 교체하였다. 대조군으로서 PAA가 포함되지 않은 배지를 사용하였다. 우리는 분화시작 후 1, 3, 5일째에 근관세포의 길이와 지름을 측정함으로써 PAA가 근관 형성에 미치는 영향을 평가하였고, quantitative real-time polymerase chain reaction 분석을 통해 PAA가 근육 표지인자(myoblast determination protein 1, myogenin, myocyte enhancer factor 2C, muscle creatine kinase, 및 myosin heavy chain)와 근육위축 관련 유전자(atrogin-1과 muscle ring finger-1 [MuRF-1])의 발현에 미치는 영향을 분석하였다. 또한, 주요 근육형성 키나아제인 protein kinase B (Akt)의 인산화를 웨스턴 블롯을 이용해 관찰하였다. 그 결과 PAA가 더 작고 얇은 근관 형성을 유의하게 유발하며 근육 표지인자의 발현을 감소시킨다는 것을 확인하였다. 또한, atrogin-1과 MuRF-1의 발현이 PAA에 의해서 감소하였는데, 이는 Akt 인산화의 감소와 일치하는 결과이다. 결론적으로, 본 연구결과는 PAA가 Akt 인산화와 활성화를 감소시킴으로써 C2C12 세포에서의 근육 분화를 억제하는 역할을 한다는 것을 증명한다.

None

This research was supported by “Regional Inno-vation Strategy (RIS)” through the National Research Foun-dation of Korea (NRF) funded by the Ministry of Educa-tion (MOE) (2021RIS-001(1345370811)), and Basic Science Research Program through the National Research Foun-dation of Korea (NRF) funded by the Ministry of Educa-tion (2021R1I1A1A01041710) (2019R1I1A1A01055061).

None

Kim DA¹, Research professor; Kong KH¹, Research professor; Cho HJ², Professor; Lee MR³, Professor.

- Conceptualization: Cho HJ, Lee MR.

- Data curation: Kim DA, Kong KH.

- Formal analysis: Kim DA, Kong KH.

- Methodology: Kim DA, Kong KH.

- Software: Kim DA, Kong KH.

- Validation: Lee MR.

- Investigation: Lee MR.

- Writing - original draft: Lee MR.

- Writing - review & editing: Cho HJ, Lee MR.

This article does not require IRB approval because there are no human and animal participants.