search for   

 

Comparative Analysis of Uropathogenic Escherichia coli ST131 and Non-ST131 Isolated from Urinary Tract Infection Patients in Daejeon
Korean J Clin Lab Sci 2020;52:342-348  
Published on December 30, 2020
Copyright © 2020 Korean Society for Clinical Laboratory Science.

Hye Hyun Cho

Departments of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, Daejeon, Korea
Correspondence to: Hye Hyun Cho
Departments of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, 100 Hyechon-ro, Seo-gu, Daejeon 35408, Korea
E-mail: airplane1102@hanmail.net
ORCID: https://orcid.org/0000-0002-0471-4938
Abstract
Uropathogenic Escherichia coli (UPEC) is a major cause of urinary tract infections (UTIs), which is one of the most common infectious diseases in humans worldwide. Since UPEC is increasingly gaining resistance to many antimicrobial agents, antibiotic therapy of UTI has recently become a great concern. This study examined the epidemiological relationship, and antimicrobial resistance patterns of 84 UPEC isolates obtained from UTI patients in Daejeon, from March to December 2017. Molecular epidemiology was investigated by multilocus sequence typing (MLST), and an antimicrobial susceptibility test was determined using an E-test. In this study, UTI was more common in females (73.8%) than in males (26.2%), and the highest incidence of UTI was observed in the age group in their 70s. Among the 84 UPEC isolates, 59 isolates (70.2%) were multidrug-resistant (MDR), and the major sequence type was ST131 (44 isolates, 52.4%). Interestingly, the rates of MDR in non-ST131 isolates (72.5%) were higher compared to ST131 isolates (68.2%). These results indicate the possibility of the development and spread of MDR in non-ST131 isolates. Effective surveillance networks and continuous research need to be conducted globally to prevent the emergence and international spread of MDR non-ST131 isolates.
Keywords : MDR, Non-ST131, UPEC
서 론

요로감염(urinary tract infection, UTI)은 사람에서 가장 흔한 세균감염이고, 또한 가장 빈번하게 발생하는 원내감염 중 하나이다. 전 세계적으로 연간 약 2억 5천만 건이 발생하고 있으며, 높은 사망율과 이환율의 주요 원인이 되고 있다[1, 2]. 특히 여성에서 높은 발병율을 보이고 있으며, 급성 요로감염을 일으킨 여성의 25% 이상이 보통 6개월 이내에 재감염 된다는 보고가 있다[3-5].

Escherichia coli (E. coli)는 요로감염을 일으키는 주요 병원체로써, 90% 이상을 차지하고 있다. 또한, 요로로부터 분리된 E. coli 균주는 요로병인성 E. coli (uropathogenic E. coli, UPEC)로 알려져 있으며, 요로감염의 80% 이상을 유발하는 가장 중요한 원인균으로 보고하고 있다[6-8]. 최근 요로병인성 E. coli는 fluoroquinolones, 제3세대 cephalosporins, carbapenems 계열과 같은 항균제에 대한 내성이 증가함에 따라 점차 다제내성(multidrug resistant, MDR)으로 발전하고 있어 이에 대한 관심과 연구가 집중되고 있다[9, 10].

E. coli sequence type 131 (E. coli ST131)은 요로병인성 E. coli의 높은 빈도를 차지하는 범유행적 클론으로, 전 세계적으로 다제내성의 출현과 확산에 기여하고 있다[11, 12]. 또한, E. coli ST131은 전 세계 여러 대륙에서 extended spectrum β-lactamase (ESBL)을 생성하는 E. coli로 확인되고 있으며, fluoroquinolone 내성과 CTX-M 생성에 대한 관련성이 보고되고 있다[13, 14]. 최근 많은 연구에서 E. coli ST131은 CTX-M-15 ESBL 유전자 확산의 주요 원인으로 확인되고 있으며, 이에 대한 역학조사 결과 phylogenetic group B2와 serotype O25b:H4에 속하는 것으로 알려져 있다[12, 13, 15]. 이전 연구에 따르면, 요로병인성 E. coli를 대상으로 실험한 연구 결과에서 E. coli ST131이 가장 우세한 ST로 확인되었고, 그 밖에 많은 ST가 확인되었다. 그러나, 이전 연구에서 E. coli ST131에 대한 다양한 연구가 이루어진 반면, non-ST131과의 비교 연구는 부족한 실정이다.

이에 본 연구에서는 대전지역의 3차 병원에 입원한 요로감염 환자의 소변에서 분리된 E. coli를 대상으로, 다좌위 서열 형별분석(multilocus sequence typing, MLST)를 통한 역학조사를 실시하여 각 ST를 비교 분석하고, 이를 토대로 항균제 내성과의 관계를 조사하고자 한다.

재료 및 방법

1. 균주의 수집과 동정

본 연구는 2017년 3월부터 12월까지 대전지역의 3차 병원에 입원한 요로감염 환자의 소변에서 분리된 E. coli 84 균주를 대상으로 하였다. 이 중 동일 환자에서 반복 분리된 균주는 수집대상에서 제외하였다. 임상검체로부터 분리 배양된 균주는 Vitek 2 automated ID system (BioMerieux, Hazelwood, MO, USA)을 이용하여 동정하였다.

2. 항균제 감수성 검사

Clinical and laboratory standards institute (CLSI) 지침에 따라, amikacin, gentamicin, ceftazidime, cefotaxime, cefepime, aztreonam, ertapenem, imipenem, ciprofloxacin, piperacillin-tazobactam 및 trimethoprim-sulfamethoxazole (BioMerieux)에 대한 항균제 감수성 검사는 Mueller-Hinton 한천배지(Difco, Cockeysville, MD, USA)를 사용하여 E-test법으로 확인하였다[16]. 정도관리를 위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을 동시에 시험하여 허용범위 내에 있는지 확인하였다. Magiorakos 등[10]의 연구를 참고하여, aminoglycosides, 광범위 cephalosporins, carbapenems 및 fluoroquinolones 계열 등의 항균제 중 3계열 이상의 항균제에 내성을 보인 균주를 다제내성 E. coli로 하였다.

3. Multilocus sequencing typing (MLST) 분석

MLST는 E. coli MLST database website (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli)에 설명된 방법에 따라 분석하였다. 먼저, 대상 균주는 brain heart infusion broth (Difco)에 접종하여 37°C에서 24시간 배양한 후, Genomic DNA Prep Kit (Solgent, Daejeon, Korea)을 사용하여 DNA를 추출하였다. DNA 추출액(5 μL), 10x Taq buffer (2.5 μL), 10 mM dNTP mix (0.5 μL), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및 증류수를 혼합하여 총 부피 25 μL의 반응용액을 만들었다. 7개의 housekeeping gene (adk, fumC, gyrB, icd, mdh, purA, recA)은 Gene Amp PCR System 9600 (Perkin-Elmer, Norwalk, CT, USA)을 사용하여 95°C에서 2분간 반응시킨 후, 95°C에서 1분, annealing temperature에서 1분, 72°C에서 2분으로 30회 증폭 반응시키고, 72°C에서 5분간 연장 반응시켰다(Table 1). 각각의 PCR 반응산물은 ethidium bromide가 포함된 1% agarose gel에서 30분간 전기영동하여 밴드를 확인하였다. 증폭산물은 PCR purification kit (Solgent)로 분리한 후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA)와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를 이용하여 염기서열을 분석하였다. 7개의 housekeeping gene에 대한 각각의 염기서열 분석 결과는 MLST database에 입력하여 allelic number와 sequence type (ST)를 확인하였다.

Oligonucleotides primers used for MLST

Gene Sequence (5’-3’) Product length (bp) Annealing temperature (°C)
adk F: ATTCTGCTTGGCGCTCCGGG 583 54
R: CCGTCAACTTTCGCGTATTT
fumC F: TCACAGGTCGCCAGCGCTTC 806 54
R: GTACGCAGCGAAAAAGATTC
gyrB F: TCGGCGACACGGATGACGGC 911 60
R: ATCAGGCCTTCACGCGCATC
icd F: ATGGAAAGTAAAGTAGTTGTTCCGGCACA 878 54
R: GGACGCAGCAGGATCTGTT
mdh F: ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 932 60
R: TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
purA F: CGCGCTGATGAAAGAGATGA 816 54
R: CATACGGTAAGCCACGCAGA
recA F: CGCATTCGCTTTACCCTGACC 780 58
R: TCGTCGAAATCTACGGACCGGA

결 과

1. MLST 결과 분석

요로감염 환자의 소변에서 분리된 E. coli 84 균주를 대상으로 MLST를 시행한 결과, 총 16개의 ST를 확인하였다(Table 2). 16개의 ST 중 가장 높은 빈도의 유형은 ST131이었고, 총 84 균주 중 44 균주(52.4%)에서 확인되었다. ST1193이 19 균주(22.6%)로 두 번째로 높은 빈도를 차지하였고, 순차적으로 ST648이 4 균주(4.8%), ST5150이 3 균주(3.6%), ST1148과 ST2003이 각각 2 균주(2.4%)로 확인되었다. 나머지 10개의 ST (ST38, ST69, ST93, ST224, ST410, ST450, ST1177, ST2179, ST2599, ST4204)는 각각 1 균주(1.2%)에서 확인되었다.

MLST analysis of E. coli isolated from 84 urine samples

ST Allelic profile No. of isolates (%)

adk fumC gyrB icd mdh purA recA
131 53 40 47 13 36 28 29 44 (52.4)
1193 14 14 10 200 17 7 10 19 (22.6)
648 92 4 87 96 70 58 2 4 (4.8)
5150 4 26 2 501 5 5 19 3 (3.6)
1148 6 95 3 18 11 7 14 2 (2.4)
2003 4 26 2 25 4 5 19 2 (2.4)
38 4 26 2 25 5 5 19 1 (1.2)
69 21 35 27 6 5 5 4 1 (1.2)
93 6 11 4 10 7 8 6 1 (1.2)
224 6 4 33 16 11 8 6 1 (1.2)
410 6 4 12 1 20 18 7 1 (1.2)
450 6 11 95 104 8 7 2 1 (1.2)
1177 4 26 2 211 5 5 19 1 (1.2)
2179 9 65 5 18 11 8 6 1 (1.2)
2599 267 6 5 26 9 13 98 1 (1.2)
4204 24 11 4 8 8 8 73 1 (1.2)


2. 요로감염 환자의 성별, 연령별 분포 확인

2017년 3월부터 12월까지 대전지역의 3차 병원에 입원한 요로감염 환자 84명을 대상으로 성별 분포를 확인한 결과, 남성 22명(26.2%), 여성 62명(73.8%)으로, 여성이 남성보다 2.8배 높은 분포를 보였다(Table 3). 또한, 연령별 분포를 확인한 결과, 70대에서 총 84명 중 31명(36.9%)이 확인되어 가장 높은 분포를 보였다. 순차적으로 60대가 13명(15.5%), 80대가 11명(13.1%), 50대가 10명(11.9%), 10대 미만이 6명(7.1%), 40대가 5명(6.0%), 20대가 4명(4.8%), 30대가 2명(2.4%), 10대와 90대가 각각 1명(1.2%)의 분포를 보였다. 연령에 따른 성별 분포를 확인하면 남성(40.9%, 9명)과 여성(35.5%, 22명) 모두 70대에서 가장 높은 분포를 보였으며, 여성의 경우 모든 연령대에서 분포가 확인되었다. ST131과 non-ST131에 따른 성별 분포에서 ST131이 확인된 환자 44명 중 남성은 12명(27.3%), 여성은 32명(72.7%)이었고, non-ST131이 확인된 환자 40명 중 남성은 10명(25.0%), 여성은 30명(75.0%)으로, 모두 여성이 남성보다 각각 2.7배, 3배 높은 분포를 보였다. 또한, ST131과 non-ST131에 따른 성별 및 연령별 분포에서 ST131과 non-ST131이 확인된 환자의 남성과 여성 모두 70대에서 가장 높은 분포를 보였으나, ST131이 확인된 환자의 경우, 여성이 46.9%의 분포를 보인 반면, non-ST131이 확인된 환자의 경우, 남성이 50.0%의 분포를 보였다.

Distribution of gender and age between ST131 and non-ST131 E. coli isolates

Age group No. of isolates (%)

Total (N=84) ST131 (N=44) Non-ST131 (N=40)



Total Male Female Male Female Male Female
1∼9 6 (7.1) 4 (18.2) 2 (3.2) 2 (16.7) 0 (0.0) 2 (20.0) 2 (6.7)
10∼19 1 (1.2) 0 (0.0) 1 (1.6) 0 (0.0) 0 (0.0) 0 (0.0) 1 (3.3)
20∼29 4 (4.8) 1 (4.5) 3 (4.8) 1 (8.3) 2 (6.3) 0 (0.0) 1 (3.3)
30∼39 2 (2.4) 0 (0.0) 2 (3.2) 0 (0.0) 1 (3.1) 0 (0.0) 1 (3.3)
40∼49 5 (6.0) 2 (9.1) 3 (4.8) 1 (8.3) 2 (6.3) 1 (10.0) 1 (3.3)
50∼59 10 (11.9) 2 (9.1) 8 (12.9) 2 (16.7) 2 (6.3) 0 (0.0) 6 (20.0)
60∼69 13 (15.5) 3 (13.6) 10 (16.1) 2 (16.7) 6 (18.8) 1 (10.0) 4 (13.3)
70∼79 31 (36.9) 9 (40.9) 22 (35.5) 4 (33.3) 15 (46.9) 5 (50.0) 7 (23.3)
80∼89 11 (13.1) 1 (4.5) 10 (16.1) 0 (0.0) 4 (12.5) 1 (10.0) 6 (20.0)
90∼99 1 (1.2) 0 (0.0) 1 (1.6) 0 (0.0) 0 (0.0) 0 (0.0) 1 (3.3)
Total 84 (100.0) 22 (100.0) 62 (100.0) 12 (100.0) 32 (100.0) 10 (100.0) 30 (100.0)

Abbreviation: MDR, multidrug resistant.



3. 항균제 감수성 양상 분석

총 84 균주의 E. coli를 대상으로 항균제 감수성 검사를 실시한 결과, gentamicin에 54.8%(46 균주), cefotaxime에 58.3% (49 균주), ciprofloxacin에 100.0% (84 균주), trimethoprim– sulfamethoxazole에 60.7% (51 균주)의 높은 내성율을 보였으며, ceftazidime에 26.2% (22 균주), cefepime에 25.0% (21 균주), aztreonam에 41.7% (35 균주)의 내성율을 보였다(Table 4). amikacin과 piperacillin-tazobactam은 각각 3.6% (3 균주)와 6.0% (5 균주)로 비교적 낮은 내성율을 보였으며, ertapenem과 imipenem에는 84 균주 모두 내성을 보이지 않았다.

Pattern of 11 antimicrobial resistance between ST131 and non-ST131 E. coli isolates

Antimicrobial agents No. of isolates (%)

ST131 (N=44) Non-ST131 (N=40)


S I R S I R
Amikacin 43 (97.7) 0 (0.0) 1 (2.3) 38 (95.0) 0 (0.0) 2 (5.0)
Gentamicin 18 (40.9) 1 (2.3) 25 (56.8) 19 (47.5) 0 (0.0) 21 (52.5)
Ceftazidime 31 (70.5) 1 (2.3) 12 (27.3) 30 (75.0) 0 (0.0) 10 (25.0)
Cefotaxime 18 (40.9) 0 (0.0) 26 (59.1) 17 (42.5) 0 (0.0) 23 (57.5)
Cefepime 25 (56.8) 4 (9.1) 15 (34.1) 26 (65.0) 8 (20.0) 6 (15.0)
Aztreonam 26 (59.1) 0 (0.0) 18 (40.9) 23 (57.5) 0 (0.0) 17 (42.5)
Ertapenem 44 (100.0) 0 (0.0) 0 (0.0) 40 (100.0) 0 (0.0) 0 (0.0)
Imipenem 44 (100.0) 0 (0.0) 0 (0.0) 40 (100.0) 0 (0.0) 0 (0.0)
Ciprofloxacin 0 (0.0) 0 (0.0) 44 (100.0) 0 (0.0) 0 (0.0) 40 (100.0)
Piperacillin-tazobactam 36 (81.8) 5 (11.4) 3 (6.8) 36 (90.0) 2 (5.0) 2 (5.0)
Trimethoprim-sulfamethoxazole 19 (43.2) 0 (0.0) 25 (56.8) 14 (35.0) 0 (0.0) 26 (65.0)

Abbreviations: S, susceptible; I, intermediate; R, resistant.



ST131과 non-ST131의 항균제 감수성 결과에서, 11개의 항균제 중 10개의 항균제에 대한 내성율은 유사하였으나, cefepime의 경우, ST131의 내성율(34.1%)이 non-ST131의 내성율(15.0%)보다 2.3배 높은 결과를 보였다. 이러한 결과를 토대로, 총 84 균주 중 59 균주(70.2%)가 MDR로 확인되었으며, 나머지 25 균주(29.8%)가 non-MDR로 확인되었다(Table 5). 또한, ST131에서 MDR은 68.2% (30 균주)인 반면, non-ST131에서 MDR은 72.5% (29 균주)로, ST131보다 1.1배 높은 결과를 보였으며, 11개의 ST가 확인되었다.

Distribution of MDR and non-MDR between ST131 and non-ST131 E. coli isolates

Specific trait ST131 (N=44) Non-ST131 (N=40)


N (%) ST (N) N (%) ST (N)
MDR 30 (68.2) ST131 (30) 29 (72.5) ST1193 (13), ST648 (3), ST5150 (3), ST1148 (2), ST2003 (2), ST38 (1), ST69 (1), ST410 (1), ST1177 (1), ST2179 (1), ST2599 (1)
Non-MDR 14 (31.8) ST131 (14) 11 (27.5) ST1193 (6), ST93 (1), ST224 (1), ST450 (1), ST648 (1), ST4204 (1)

고 찰

본 연구에서 요로감염의 성별에 따른 유병율을 확인한 결과, 여성(73.8%)이 남성(26.2%)보다 약 2.8배 높은 결과를 보였다. 미국, 포르투갈, 멕시코, 나이지리아, 대만, 인도, 파키스탄과 같은 세계 다른 지역에서 이전 연구한 결과와 일치하였다. 이러한 결과는 남성과 여성 생식기의 해부학적 구조 차이로, 여성의 요도가 질과 항문에 인접하고, 짧은 외부 개구부로써, 세균감염에 취약한 것으로 보고하고 있다[17, 18]. 또한, Dadi 등[1]와 Matsui 등[19]의 연구에 의하면, 30∼40대에서 가장 높은 발생율을 보인 반면, 본 연구에서는 70대(36.9%)에서 가장 높은 발생율을 확인하였으며 30∼40대의 경우, 8.3%로 확인되어 이전 연구와 다른 결과를 보였다. ST131과 non-ST131의 성별, 연령별 분포는 모두 여성과 70대에서 가장 높은 분포가 확인되어 큰 차이점은 발견되지 않았다.

요로병인성 E. coli는 아시아(50∼80%), 아프리카(60.29%), 유럽(60∼90%) 및 북미, 라틴 아메리카 국가(75∼90%)에서 요로감염을 유발하는 가장 흔한 원인균으로 보고되고 있다[17, 20]. 이러한 요로병인성 E. coli 중 전 세계적으로 ST131이 유행하고 있는 가운데, 본 연구에서도 ST131이 52.4%의 가장 높은 빈도로 확인되었다. Phylogenetic group B2에 속하는 E. coli ST131은 fluoroquinolone 내성과 ESBL 생성 이외에도 특정 병독성 인자와 항균제 내성과의 연관성으로 인해 다제내성균으로 발전 및 확산되고 있으며, 이는 환자의 치료에 심각한 위협을 초래하고 있다[21-23]. 이와 유사하게, 본 연구에서 두 번째로 높은 빈도를 차지한 ST1193 (22.6%)은 최근 장외감염의 주요 원인으로, 병독성과 다제내성을 보이는 새로운 E. coli로 출현하고 있다[24]. 또한, 호주, 중국, 노르웨이, 독일, 미국의 이전 연구에서 phlyogenetic group B2에 속하며, fluoroquinolone에 대한 내성을 보고하였다[19].

최근 연구에서 요로병인성 E. coli의 항균제에 대한 내성이 증가함에 따라, 요로감염의 치료를 위한 항균제의 선택과 사용이 전 세계적으로 문제가 되고 있다[9, 25]. 본 연구에서 gentamicin (54.8%), cefotaxime (58.3%), ciprofloxacin (100.0%), trimethoprim-sulfamethoxazole (60.7%)은 50% 이상의 높은 내성을 보였고, amikacin (3.6%), piperacillin-tazobactam (6.0%)은 10% 이하의 낮은 내성을 보였으며, imipenem과 ertapenem은 감수성을 보였다. 앞서 Norouzian 등[5]과 Cheung 등[20]의 연구에서 fluoroquinolone과 trimethoprim-sulfamethoxazole에 높은 내성을 확인하였고, amikacin, piperacillin-tazobactam, carbapenem에 낮은 내성과 감수성을 확인하여, 요로감염 치료제로써의 적합성과 유용성을 보고하였다. ST131과 non-ST131에서 10개의 항균제에 대한 내성율은 거의 유사한 결과를 보였으나, cefepime의 경우, ST131이 약 2.3배 높은 내성율을 보였다. 이러한 결과는 2020년 우리나라에서 발표한 Kim 등의 연구에서도 ST131의 cefepime 내성율이 non-ST131보다 2.9배(22.9% vs 8.0%) 높은 것을 확인하였다[26]. 또한, 2013년 인도에서 발표한 Mukherjee 등[27]의 연구에 따르면, 요로병인성 E. coli 중 92.5%가 MDR로 확인되었으며, 2015년 이란에서 발표한 Iranpour 등[28]의 연구에서도 82%가 MDR로 확인되었다. 본 연구에서는 총 84 균주 중 70.2% (59 균주)가 MDR로 확인되어 이전 연구 결과보다 비교적 낮은 결과를 확인하였다. 또한, 사우디아라비아에서 발표한 Alqasim 등[15]의 이전 연구에서 ST131과 non-ST131에서의 MDR은 각각 83.7%와 60.9%로 확인되어 ST131에서의 MDR이 non-ST131보다 높은 결과를 확인하였다. 이에 반해, 본 연구에서 ST131과 non-ST131에서의 MDR은 각각 68.2%와 72.5%로, non-ST131에서의 MDR이 ST131보다 높은 결과를 확인하였으며, 이러한 결과는 non-ST131에서의 MDR이 점차 증가하고 있는 것으로 사료된다. 이전 많은 연구에서 다제내성의 출현과 확산에 기여하는 범유행적 클론으로 ST131에 대한 연구가 집중되었으나, 본 연구 결과, 최근 non-ST131에서 MDR의 발전 및 확산 가능성이 우려되므로, 이에 대한 많은 연구가 요구된다. 본 연구 결과, 대전지역의 3차 병원에 입원한 요로감염 환자는 대다수가 여성으로, 남성보다 2.8배 높았으며, 70대에서 가장 높은 분포를 확인하였다. 요로감염 환자의 소변에서 분리된 E. coli 84 균주의 항균제 감수성 결과, 70.2%가 다제내성으로 확인되어, 제한적인 항균제의 선택과 사용이 불가피한 실정이다. 또한, ST131과 non-ST131은 성별, 연령별 분포에서 모두 여성과 70대에서 가장 높은 분포를 보여 큰 차이가 확인되지 않았다. 그러나 흥미롭게도 ST131과 non-ST131에서 MDR의 분포는 ST131보다 non-ST131에서 더 높은 결과를 보임에 따라 non-ST131에서 MDR의 발달과 확산이 우려되고 있다. 향후 non-ST131에서 MDR의 발달 및 확산을 예방하기 위한 효과적인 감시 체계와 실질적인 연구가 개발되어야 할 것으로 사료된다.

요 약

전 세계적으로 요로감염은 사람에서 가장 흔한 감염 질환 중 하나로, 요로병인성 E. coli는 요로감염의 주요 원인균이다. 요로병인성 E. coli는 많은 항균제에 대한 내성이 점차 증가하고 있어, 최근 요로감염의 항균제 치료에 큰 우려를 낳고 있는 실정이다. 본 연구는 2017년 3월부터 12월까지, 대전지역의 요로감염 환자에서 분리된 요로병인성 E. coli 84 균주를 대상으로 역학관계와 항균제 내성 양상을 조사하였다. 역학 관계를 확인하기 위해 다좌위 서열 형별분석(MLST)를 실시하였고, 항균제 감수성 시험은 E-test법으로 확인하였다. 본 연구 결과, 요로감염은 남성(26.2%)보다 여성(73.8%)에서 더 흔한 분포를 보였고, 70대가 가장 높은 분포의 연령대로 확인되었다. 84 균주의 요로병인성 E. coli 중, 59 균주(70.2%)가 다제내성이었으며, 주요 seqeunce type은 ST131 (44 균주, 52.4%)임을 확인하였다. 흥미롭게도, non-ST131에서 다제내성의 비율(72.5%)이 ST131 (68.2%)보다 더 높은 결과를 확인하였다. 이러한 연구 결과는 non-ST131에서의 다제내성의 발달과 확산 가능성을 의미하는 것으로 해석된다. 다제내성 non-ST131의 출현과 국제적인 확산을 예방하기 위해, 전 세계적으로 효과적인 감시 체계와 지속적인 연구가 수행되어야 할 것으로 사료된다.

Acknowledgements

None

Conflict of interest

None

Author’s information (Position)

Cho HH, Professor.

References
  1. Dadi BR, Abebe T, Zhang L, Mihret A, Abebe W, Amogne W. Distribution of virulence genes and phylogenetics of uropathogenic Escherichia coli among urinary tract infection patients in Addis Ababa, Ethiopia. BMC Infect Dis. 2020;20:108. https://doi.org/10.1186/s12879-020-4844-z.
    Pubmed KoreaMed CrossRef
  2. Foxman B. The epidemiology of urinary tract infection. Nat Rev Urol. 2010;7:653-660. https://doi.org/10.1038/nrurol.2010.190.
    Pubmed CrossRef
  3. Hooton TM. Recurrent urinary tract infection in women. Int J Antimicrob Agents. 2001;17:259-268. https://doi.org/10.1016/s0924-8579(00)00350-2.
    CrossRef
  4. Foxman B. Recurring urinary tract infection: incidence and risk factors. Am J Public Health. 1990;80:331-333. https://doi.org/10.2105/ajph.80.3.331.
    Pubmed KoreaMed CrossRef
  5. Norouzian H, Katouli M, Shahrokhi N, Sabeti S, Pooya M, Bouzari S. The relationship between phylogenetic groups and antibiotic susceptibility patterns of Escherichia coli strains isolated from feces and urine of patients with acute or recurrent urinary tract infection. Iran J Microbiol. 2019;11:478-487.
    Pubmed KoreaMed CrossRef
  6. Loh K, Sivalingam N. Urinary tract infections in pregnancy. Malays Fam Physician. 2007;2:54-57.
    Pubmed KoreaMed
  7. Schwartz DJ1, Kalas V, Pinkner JS, Chen SL, Spaulding CN, Dodson KWDodson KW, et al. Positively selected FimH residues enhance virulence during urinary tract infection by altering FimH conformation. Proc Natl Acad Sci U S A. 2013;110:15530-15537. https://doi.org/10.1073/pnas.1315203110.
    Pubmed KoreaMed CrossRef
  8. Ronald A. The etiology of urinary tract infection: traditional and emerging pathogens. Am J Med. 2002;113:14S-19S. https://doi.org/10.1016/s0002-9343(02)01055-0.
    Pubmed CrossRef
  9. Zowawi HM, Harris PN, Roberts MJ, Tambyah PA, Schembri MA, Pezzani MDPezzani MD, et al. The emerging threat of multidrug-resistant Gram-negative bacteria in urology. Nat Rev Urol. 2015;12:570-584. https://doi.org/10.1038/nrurol.2015.199.
    Pubmed CrossRef
  10. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CGGiske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18:268-281. https://doi.org/10.1111/j.1469-0691.2011.03570.x.
    Pubmed CrossRef
  11. Alghoribi MF, Gibreel TM, Farnham G, Al Johani SM, Balkhy HH, Upton M. Antibiotic-resistant ST38, ST131 and ST405 strains are the leading uropathogenic Escherichia coli clones in Riyadh, Saudi Arabia. J Antimicrob Chemother. 2015;70:2757-2762. https://doi.org/10.1093/jac/dkv188.
    Pubmed CrossRef
  12. Nicolas-Chanoine MH, Bertrand X, Madec JY. Escherichia coli ST131, an intriguing clonal group. Clin Microbiol Rev. 2014;27:543-574. https://doi.org/10.1128/CMR.00125-13.
    Pubmed KoreaMed CrossRef
  13. Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, Caniça MMCaniça MM, et al. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61:273-281. https://doi.org/10.1093/jac/dkm464.
    Pubmed CrossRef
  14. Peirano G, Pitout JD. Molecular epidemiology of Escherichia coli producing CTX-M beta-lactamases: the worldwide emergence of clone ST131 O25:H4. Int J Antimicrob Agents. 2010;35:316-321. https://doi.org/10.1016/j.ijantimicag.2009.11.003.
    Pubmed CrossRef
  15. Alqasim A, Abu Jaffal A, Alyousef AA. Prevalence and molecular characteristics of sequence type 131 clone among clinical uropathogenic Escherichia coli isolates in Riyadh, Saudi Arabia. Saudi J Biol Sci. 2020;27:296-302. https://doi.org/10.1016/j.sjbs.2019.09.020.
    Pubmed KoreaMed CrossRef
  16. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, M100-S20. Wayne, PA: Clinical and Laboratory Standards Institute; 2010.
  17. Mortazavi-Tabatabaei SAR, Ghaderkhani J, Nazari A, Sayehmiri K, Sayehmiri F, Pakzad I. Pattern of antibacterial resistance in urinary tract infections: A systematic review and meta-analysis. Int J Prev Med. 2019;10:169. https://doi.org/10.4103/ijpvm.IJPVM_419_17.
    Pubmed KoreaMed CrossRef
  18. Kothari A, Sagar V. Antibiotic resistance in pathogens causing community-acquired urinary tract infections in India: A multicenter study. J Infect Dev Ctries. 2008;2:354-358. https://doi.org/10.3855/jidc.196.
    CrossRef
  19. Matsui Y, Hu Y, Rubin J, de Assis RS, Suh J, Riley LW. Multilocus sequence typing of Escherichia coli isolates from urinary tract infection patients and from fecal samples of healthy subjects in a college community. Microbiologyopen. 2020;9. https://doi.org/10.1002/mbo3.1032.
    Pubmed KoreaMed CrossRef
  20. Cheung DA, Nicholson A, Butterfield TR, da Costa M. Prevalence, co-infection and antibiotic resistance of Escherichia Coli from blood and urine samples at a hospital in Jamaica. J Infect Dev Ctries. 2020;14:146-152. https://doi.org/10.3855/jidc.11361.
    Pubmed CrossRef
  21. Gonçalves LF, de Oliveira Martins-Júnior P, de Melo ABF, da Silva RCRM, de Paulo Martins V, Pitondo-Silva APitondo-Silva A, et al. Multidrug resistance dissemination by extended-spectrum β-lactamase-producing Escherichia coli causing community-acquired urinary tract infection in the Central-Western Region, Brazil. J Glob Antimicrob Resist. 2016;6:1-4. https://doi.org/10.1016/j.jgar.2016.02.003.
    Pubmed CrossRef
  22. da Cruz Campos AC, Cavallo FM, L Andrade N, van Dijl JM, Couto N, Zrimec JZrimec J, et al. Determining the virulence properties of Escherichia coli ST131 containing bacteriocin-encoding plasmids using short- and long-read sequencing and comparing them with those of other E. coli lineages. Microorganisms. 2019;7:E534. https://doi.org/10.3390/microorganisms7110534.
    Pubmed KoreaMed CrossRef
  23. Plantamura J, Bousquet A, Védy S, Larréché S, Bigaillon C, Delacour HDelacour H, et al. Molecular epidemiological of extended-spectrum β-lactamase producing Escherichia coli isolated in Djibouti. Infect Dev Ctries. 2019;13:753-758. https://doi.org/10.3855/jidc.11283.
    Pubmed CrossRef
  24. Wu J, Lan F, Lu Y, He Q, Li B. Molecular characteristics of ST1193 clone among phylogenetic group B2 non-ST131 fluoroquino-lone-resistant Escherichia coli. Front Microbiol. 2017;8:2294. https://doi.org/10.3389/fmicb.2017.02294.
    Pubmed KoreaMed CrossRef
  25. Manges AR, Johnson JR, Foxman B, O'Bryan TT, Fullerton KE, Riley LW. Widespread distribution of urinary tract infections caused by a multidrug-resistant Escherichia coli clonal group. N Engl J Med. 2001;345:1007-1013. https://doi.org/10.1056/NEJMoa011265.
    Pubmed CrossRef
  26. Kim B, Seo MR, Kim J, Kim Y, Wie SH, Ki MKi M, et al. Molecular epidemiology of ciprofloxacin-resistant Escherichia coli isolated from community-acquired urinary tract infections in Korea. Infect Chemother. 2020;52:194-203. https://doi.org/10.3947/ic.2020.52.2.194.
    Pubmed KoreaMed CrossRef
  27. Mukherjee M, Basu S, Mukherjee SK, Majumder M. Multidrug-resistance and extended spectrum beta-lactamase production in uropathogenic E. Coli which were isolated from hospitalized patients in Kolkata, India. J Clin Diagn Res. 2013;7:449-453. https://doi.org/10.7860/JCDR/2013/4990.2796.
    Pubmed KoreaMed CrossRef
  28. Iranpour D, Hassanpour M, Ansari H, Tajbakhsh S, Khamisipour G, Najafi A. Phylogenetic groups of Escherichia coli strains from patients with urinary tract infection in Iran based on the new clermont phylotyping method. Biomed Res Int. 2015;2015. https://doi.org/10.1155/2015/846219.
    Pubmed KoreaMed CrossRef

Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information