search for   

 

Seasonal Prevalence of Ticks at Bukhansan Dullegil and Detection of Severe Fever with Thrombocytopenia Syndrome Virus
Korean J Clin Lab Sci 2020;52:143-149  
Published on June 30, 2020
Copyright © 2020 Korean Society for Clinical Laboratory Science.

Jang-Hoon Seo1, Bo-Young Jeon2, Sezim Monoldorova2, In-Yong Lee3

1Department of Biomedical Laboratory Science, Shinhan University, Uijeongbu, Korea
2Department of Biomedical Laboratory Science, College of Health Science, Yonsei University, Wonju, Korea
3Institute of Tropical Medicine, College of Medicine, Yonsei University, Seoul, Korea
Correspondence to: Jang-Hoon Seo
Department of Biomedical Laboratory Science Shinhan University, 95 Hoam-ro, Uijeongbu 11644, Korea
E-mail: bio93sky@nate.com
ORCID: https://orcid.org/0000-0001-5986-8590
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
The study examined the seasonal pattern of larvae, nymph, and adult life stages for Haemaphysalis longicornis and the rate of infection with severe fever from the thrombocytopenia syndrome virus in ticks collected from 12 sections (Jichukdong), 14 sections (Uldaeri), and 18 sections (Howondong) in Bukhansan dullegil for April–October 2019. Haemaphysalis longicornis ticks have been considered the main vector for severe fever with thrombocytopenia syndrome (SFTS). Haemaphysalis flava and Ixodes nipponensis were collected using the dragging and flagging method. The ratios of Haemaphysalis longicornis of the collected ticks were 91% (Jichukdong), 94% (Uldaeri), and 98% (Howondong). Monthly distributional studies of Haemaphysalis longicornis based on the developmental stage showed that the adults peaked in September while nymphs were collected more frequently from April through June. The larvae peaked in September and October. SFTS virus detection was performed using 2 × OneStep RT-PCR and nested PCR. On the other hand, no SFTS virus-specific gene was detected in 1,158 ticks of Haemaphysalis longicornis. This result provides estimates of the population densities for the life stages of Haemaphysalis longicornis and the associated disease risk in Bukhansan dullegil, where many people have visited since opening in 2010.
Keywords : Haemaphysalis longicornis, Tick, Severe fever with thrombocytopenia syndrome
서 론

참진드기는 모기, 벼룩, 이, 등에모기에 비해 한 살이가 길고 숙주동물에 긴 시간 머물며 피를 많이 흡혈하며 여러 가지 영향을 주고 있다. 참진드기 매개질병은 대부분 야생동물, 설치류 및 사람까지 전파되는 절지동물 매개 인수공통감염질환이다[1]. 참진드기가 흡혈할 때 항응고제 등의 성분이 함유된 타액을 숙주의 피부에 주입하게 되는데 이 때 진드기에 감염되어 있던 세균, 바이러스, 기생충 등이 숙주 체내로 함께 유입되어 감염되기 때문에 진드기가 매개체 역할을 한다[2]. 참진드기는 흡혈해야 하는 숙주동물이 꼭 필요하다. 숙주동물에 기생하는 방법에 따라 제 1숙주 진드기, 제 2숙주 진드기, 제 3숙주 진드기로 나눈다. 제 3숙주 진드기는 질병을 매개하여 의학적으로 중요하다. 제 3숙주 진드기는 참진드기의 각 성숙 단계마다 별도의 숙주를 필요로 하며, 흡혈 후 매번 탈락하여 땅에서 탈피한다. 대부분의 참진드기가 이 방법으로 발육하는데 작은소피참진드기도 제 3숙주 진드기에 해당한다[1].

중증열성혈소판감소증후군(severe fever with thrombocytopenia syndrome, SFTS)은 고열, 소화기 증상, 혈소판 감소, 백혈구 감소증을 특징으로 하는 중증열성 바이러스성 질환으로 2010년에 중국에서 처음 보고되었고, 그 이후 일본과 한국에서 발견되었으며, 매년 환자가 발생하는 질병이다[3, 4]. 2009년 6월에 중국 허난성에서 발생한 환자에서 바이러스가 분리되었다. 중국에서 발생한 환자의 남녀 비는 여성이 53.3%로 남성보다 약간 더 많았으며 환자의 나이는 58세 전후 장년층에서 주로 발생하였다. 발생 시기는 4월부터 11월까지이며 대개 7∼8월에 집중적으로 발생하고 있다[5]. 우리나라의 SFTS는 강원도 춘천시에 거주하던 63세 여성에서 처음으로 확진되었다. 이 환자는 2012년 8월에 발열, 백혈구 감소증, 혈소판 감소증이 발생하였으며 다 장기 부전으로 사망하였다. 환자의 혈액에서 SFTSV가 분리되어 2013년 5월에 보고되었다. SFTS 환자는 바이러스에 노출된 후 4∼15일의 잠복기를 거쳐 피로, 복통, 근육통, 고열 등 증상이 나타나고 혈소판 감소증, 림프절 비대, 백혈구 감소증 등의 징후가 특징이다. 원인 병원체는 BunyaviridaePhlebovirus속에 속하는 SFTS 바이러스로서, 음성가닥의 RNA를 유전자로 갖는데 이는 총 3개의 분절(큰 분절 large [L] segment, 중간 분절 medium [M] segment, 작은 분절 small [S] segment)로 구성되어 있다[6]. 우리나라의 SFTS 환자는 2013년 36건, 2014년 55건, 2015년 79건, 2016년 165건, 2017년 212건으로 매년 증가 추세에 있으며, 2013년 첫 환자 발생 이후 제4군 법정감염병으로 지정하며 관리하고 있다[7].

북한산 둘레길은 정상 정복 위주의 산행에서 벗어나 북한산 자락을 완만하게 걸을 수 있도록 조성된 저지대 수평 산책로로 2010년 8월 44 km 구간을 역사와 문화, 생태를 체험할 수 있도록 조성되었다. 북한산 둘레길은 자연환경의 보전 측면에서 정상 정복위주의 등산객을 분산시키려는 목적이 강하였고 또한 많은 사람들이 건강한 삶을 추구하면서 실제 이용객도 더 증가할 것이다[8]. 자연보호와 기후온난화에 따른 야생동물의 증가와 함께 흡혈을 반드시 해야 하는 참진드기의 특성상 관련 매개 질병 또한 계속 발생될 것으로 보인다. 그러므로 참진드기의 다발적 접촉예상지점과 그 시기를 예측하여 특정지역, 특정시기에 집중 관리함으로써 감염예방 효율성을 높일 필요가 있다. 따라서 연중 발생밀도와 진드기 서식 실태조사를 세분화하고자 본 연구에서는 북한산 둘레길 12구간(지축동 37°41'04.8"N 126° 58'05.7"E), 14구간(울대리 37°43'06.3"N 126°59'39.1"E), 18구간(호원동 37°42'39.3"N 127°02'07.2"E)에서 참진드기를 월별로 채집하여 계절적 분포조사를 하고 매개체의 중증열성혈소판감소증후군 바이러스(SFTSV) 감염여부를 확인하였다.

재료 및 방법

1. 진드기 채집

북한산 둘레길 12구간(지축동 37°41'04.8"N 126°58'05.7"E), 14구간(울대리 37°43'06.3"N 126°59'39.1"E), 18구간(호원동 37°42'39.3"N 127°02'07.2"E)에서 반경 100 m의 산기슭, 숲길, 산책로, 잔디밭, 장목 숲 등에서 2019년 4월부터 10월까지 채집하였다. 채집방법은 면으로 된 가로, 세로 1 m 천을 이용하여 천끌기(dragging)와 천젓기(flagging) 방식으로 1회 1지역 1시간 채집하였다. 채집한 진드기는 습도를 유지하여 종을 분류한 다음 −70°C에 보관하였다.

2. 진드기 종 분류 동정

종 분류 동정은 실체현미경(×10, ×40)을 이용하여 Yamaguti 등[9]이 제시한 방법에 따라 분류 동정하였다. 작은소피참진드기의 성충은 눈(eye)은 없고 입틀(hypostome)은 둥글고 이빨(dental formula)은 5/5로 되어있고 등수염(dorsal palpal) 2마디와 배수염(ventral palpal) 3마디에는 가시돌기(spur)가 나와 있고 꽃줄무늬(festoon)는 몸 끝에 둘러져 있고 다리는 4쌍이다. 암컷은 등껍데기(scutum)가 등 앞에 있고 첫째 다리 밑마디(coxa)에 내측돌기(internal spur)는 뭉툭하며 생식공(genital aperture)은 배 쪽 가운데에 있다. 수컷은 등껍데기가 없고 첫째 다리 밑마디(coxa)에 내측돌기(internal spur)는 길며 항문홈(anal groove)이 Y자로 패여 있다. 약충은 암ㆍ수가 없고 다리는 4쌍이다. 작은머리(basis capituli)에 등가장자리(dorsal-lateral margin)는 곧게 가로로 나 있고 이빨은 3/3로 되어있다. 유충은 암ㆍ수가 없고 다리는 3쌍이다. 작은머리(basis capituli)에 등가장자리(dorsal-lateral margin)는 곧게 가로로 나 있다[10]. 종 분류가 완료된 진드기에서 발육단계별(성충, 약충, 유충)로 월별에 따른 채집 개체 비율을 비교 조사하였다.

3. 바이러스 RNA 추출

참진드기를 성장단계에 따라 약 2∼20 마리씩 pooling하였다. Pooling 한 진드기에 500 μL의 Trizol (Invitrogen Co., Carlsbad, CA, USA)를 첨가한 후 2시간 상온에서 반응시킨 후 homogenizer (Precellys homonizer, Bertin Instruments, France)를 이용하여 분쇄하였다. 분쇄한 진드기 유제액에 200 μL (phenol: choloroform: isoamylalcohol)를 첨가하여 혼합하여 원심분리한 후, 상층액을 제거하여 새로운 튜브에 옮기고 600 μL의 isopropanol을 첨가하여 −20°C에 30분간 보관하였다. 원심분리를 실시한 후 침전된 pellet을 100% 에탄올 및 70% 에탄올을 이용하여 세척하였고, 멸균증류수 30 μL를 첨가하고 50°C에 10분간 반응시켰다.

4. SFTSV 검출을 위한 PCR 조건

SFTS 바이러스 검출을 위하여 추출한 RNA를 DiaStar 2× OneStep RT-PCR premix kit (SolGent, Daejeon, Korea)을 이용하여 1차 PCR을 진행하였다. 참진드기에서 추출한 RNA 5 μL, DiaStar 2× OneStep RT-PCR premix 15 μL, SFTS MF3 primer (forward, 10 pmol) 1 μL, SFTS MR2 primer (reverse, 10 pmol) 1 μL, distilled water 8 μL을 혼합한 후 역전사반응은 50°C에서 30분과 95°C에서 15분으로 진행되었다. 그 후 증폭반응을 95°C에서 20초, 52°C에 40초, 72°C에서 1분으로 35회 진행하였고, 최종 신장과정은 72°C에서 5분 동안 진행하였다[11].

5. SFTSV 검출을 위한 nested PCR 조건

Nested PCR은 1차 증폭산물 1 μL, SFTSV 2차 forward primer (10 pmol) 1 μL, SFTSV 2차 reverse primer (10 pmol) 1 μL, HotStart PCR premix kit (Bioneer Co., Daejeon, Korea) 5 μL, distilled water 17 μL를 혼합 94°C에서 5분 반응시킨 후, 증폭 과정은 94°C에서 20초, 59°C에서 20초, 72°C에서 20초로 26회 진행하였으며, 최종 신장과정을 72°C에서 5분 동안 진행하였다[12].

결 과

2019년 4월부터 10월까지 북한산 둘레길 12구간(지축동), 14구간(울대리), 18구간(호원동)에서 진드기 서식지로 예측되는 산기슭, 숲길, 산책로, 잔디밭, 장목 숲 등을 채집지로 선택하였다. 지축동은 월 2회씩 총 14회 채집하였으며 울대리는 6월에 3회를 포함한 월 2회씩 총 15회 채집하였고 호원동은 4월, 6월에 3회를 포함한 월 2회씩 총 16회 채집하였다. 채집된 진드기는 참진드기과에 속하는 작은소피참진드기(Haemalhysalis longiconis), 개피참진드기(Haemaphysalis flava)와 일본참진드기(Ixodes nipponensis) 등 3종이었다(Table 1).

The sequences of 2× OneStep RT-nested polymerase chain reaction (PCR) primers and target size for detection of M segment of severe fever with thrombocytopenia syndrome virus

PCR steps Name of PCR primers Sequence (5’-3’) Product size (bp) Accession No.
1st round PCR SFTSV-MF3 GATGAGATGGTCCATGCTGATTCT 560 KF781489
SFTSV-MR2 CTCATGGGGTGGAATGTCCTCAC
2nd round PCR
(Nested PCR)
SFTSV-NF TAAACTTGTGTCGTGCAGGC 245 KF781513
SFTSV-NR CCCAGCGACATCTCCTTACA


조사기간 동안 북한산 둘레길 12구간 지축동에서는 총 193개체가 채집되었고 그 중 작은소피참진드기는 성충 8개체. 약충 130개체. 유충은 38개체가 채집되었다. 14구간 울대리에서는 총 219개체가 채집되었고 그 중 작은소피참진드기는 성충 16개체, 약충 120개체, 유충 70개체가 채집되었다. 18구간 호원동에서는 총 790개체가 채집되었으며 그 중 작은소피참진드기는 성충 24개체, 약충 474개체, 유충 278개체가 채집되었다. 작은소피참진드기의 경우 18구간 호원동에서 지축동과 울대리보다 3∼4배 이상 더 많은 개체수가 채집되었다. 개피참진드기는 지축동 16개체, 울대리 8개체, 호원동 12개체가 채집되었고 일본참진드기는 지축동 1개체, 울대리 5개체, 호원동 2개체가 채집되어 전체 채집 진드기 중에 작은소피참진드기는 지축동은 91%, 울대리는 94%, 호원동은 98%를 차지하였다(Table 2).

The mean (total) number of ticks collected from the three regions in Bukhansan dullegil

Regions Species of tick (mean [total]) Total

Haemaphysalis longicornis Haemaphysalis flava Ixodes nipponensis
Jichukdong 12.6 (176) 1.1 (16) 0.1 (1) 13.8 (193)
Uldaeri 13.7 (206) 0.5 (8) 0.3 (5) 14.6 (219)
Howondong 48.5 (776) 0.8 (12) 0.1 (2) 49.4 (790)
Mean (Total) No. 25.7 (1,158) 0.8 (36) 0.2 (8) 26.7 (1,202)


작은소피참진드기의 성숙단계에 따른 계절별 채집비율을 보면 성충의 경우 지축동은 5월, 8월, 9월에 채집되었고 울대리는 5월과 8월을 제외한 시기에 채집되었다. 호원동은 7월, 8월 여름을 제외한 시기에 채집되었으며 세 지역 모두 9월에 최고치를 나타내었다. 작은소피참진드기의 약충은 4월에서 6월 사이에 주로 채집되었다. 지축동은 전체 약충 채집 개체수의 68%, 울대리는 72%, 호원동은 63%가 이 시기에 채집되었다. 유충은 지축동과 울대리에서 7월, 9월, 10월에 채집되었다. 호원동은 6월에서 10월까지 꾸준히 채집되었다(Figure 1, Table 3).

The total number and monthly mean number of larvae, nymphs and adults of Haemaphysalis longicornis collected from the three regions in Bukhansan dullegil from April through October 2019

Regions Month Adult Nymphs Larvae Total
Jichukdong April 0 (0) 16 (32) 0 (0) 16 (32)
May 1 (2) 18 (36) 0 (0) 19 (38)
June 0 (0) 10 (20) 0 (0) 10 (20)
July 0 (0) 12 (24) 4 (8) 16 (32)
August 1 (2) 0 (0) 0 (0) 1 (2)
September 2 (4) 5 (10) 9 (18) 16 (32)
October 0 (0) 4 (8) 6 (12) 10 (20)
Mean (Total) No. 0.6 (8) 9.3 (130) 2.7 (38) 12.6 (176)
Uldaeri April 1 (2) 17 (34) 0 (0) 18 (36)
May 0 (0) 14 (28) 0 (0) 14 (28)
June 2 (6) 8 (24) 0 (0) 10 (30)
July 1 (2) 6 (12) 3 (6) 10 (20)
August 0 (0) 2 (4) 0 (0) 2 (4)
September 2 (4) 4 (8) 25 (50) 31 (62)
October 1 (2) 5 (10) 7 (14) 13 (26)
Mean (Total) No. 1.1 (16) 8 (120) 4.7 (70) 13.8 (206)
Howondong April 2 (6) 42 (126) 0 (0) 44 (132)
May 1 (2) 54 (108) 0 (0) 55 (110)
June 2 (6) 22 (66) 2 (6) 26 (78)
July 0 (0) 21 (42) 7 (14) 28 (56)
August 0 (0) 10 (20) 3 (6) 13 (26)
September 3 (6) 24 (48) 55 (110) 82 (164)
October 2 (4) 32 (64) 71 (142) 105 (210)
Mean (Total) No. 1.5 (24) 29.6 (474) 17.4 (278) 48.5 (776)

Fig. 1. Seasonal pattern of adults, nymphs and larvae of Haemaphysalis longicornis collected from three regions Bukhansan dullegil for 2019.

작은소피참진드기의 SFTSV 분석을 위해 1,158개체를 2∼20개체씩 나누어 pooling한 114 pool에 대해 2× OneStep RT-PCR을 실시하였으나 병원체는 검출되지 않았다(Figure 2).

Fig. 2. The results of amplication of SFTSV RNAs by RT-PCR from the pooling ticks collected from the three sections in Bukhansan dullegil. Lane M: molecular weight marker, Lane 1∼10: PCR products from the pooling ticks, Lane N: negative control, Lane P: positive control (410 bp).
고 찰

최근 들어 기후변화에 의한 온난화로 참진드기 개체수가 증가하여 진드기 매개 뇌염, 라임병, 중증열성혈소판감소증후군과 같은 진드기 매개 감염병이 증가하고 있다[13]. 2019년 4월부터 10월까지 북한산 둘레길 12, 14, 16구간 분포 조사를 통해 1,202개체의 참진드기를 채집하였다. 작은소피참진드기는 세 구간에서 모두 높은 발생밀도를 나타냈으며 개피참진드기와 일본참진드기는 채집된 개체수는 적으나 조사 지역 내 분포하고 있는 것으로 나타났다. 2018년 전국분포조사에서 나타난 작은소피참진드기 96.1%, 개피참진드기 3.1%, 일본참진드기 0.7%가 우점종으로 나타난 것과 같았다[7].

전라남도 구례군 지리산 둘레길 경우 7구간 중 4구간에서 3,869 개체가 채집되어 작은소피참진드기 3,823개체, 뭉뚝참진드기 41개체, 일본참진드기 5개체가 채집되었다[14]. 반면에 평창에서는 작은소피참진드기, 개피참진드기, 사슴피참진드기, 일본참진드기, 산림참진드기 5종이 확인되었으며 춘천에서는 산림참진드기를 제외한 4종만 채집되었다. 평창과 춘천에서 작은소피참진드기가 각각 95.6%와 63.0%로 우점종을 차지하였다[7].

계절에 따라 채집되는 작은소피참진드기는 성숙단계에 따른 차이가 있는데 성충은 4월에 시작되어 높은 비율은 아니지만 전 기간 동안 꾸준히 채집되었으며 유충의 경우에는 지축동(12구간)은 79%, 울대리(14구간)는 91%, 호원동(16구간)은 91%가 9∼10월에 채집되었다. 이것은 경기도 북부 포천과 철원지역에서 유충 채집 비율이 높게 나타난 시기와 같았다[15]. 이런 결과들은 작은소피참진드기가 하절기에 산란을 시작하여 가을철 많은 수의 유충이 채집된 것으로 보인다. 구간에 따른 채집 개체수를 보면 16구간 호원동에서는 다른 두 지역보다 약 4배 많은 개체수가 채집되어 높은 채집 비율을 보였다. 타 지역 보다 호원동 지역의 높은 채집 비율을 알기 위해 차후 각 지역 내 민가의 가축, 반려동물 개체수 그리고 야생동물밀도에 대한 조사와 함께 참진드기가 서식하는 지형적 환경을 상호 비교하는 분석이 필요하다고 사료된다.

중증열성혈소판감소증후군은 중증열성혈소판감소증후군 바이러스에 감염된 참진드기에 물려 발생하는 급성 발열성 진드기 매개 감염병이다[16]. SFTS의 감염 경로는 주로 작은소참진드기(Haemaphysalis longicomis)가 매개하여 바이러스에 감염되는 것으로 알려져 있다. 2013년 국내 중증열성혈소파감소증후군 환자가 처음으로 보고된 후 계속 증가하고 있다[17].

SFTSV는 single-standed negative sense RNA segment인 큰 분절(large [L] segment) 그리고 중간 분절(medium [M] segment) 그리고 작은 분절(small [S] segment)인 3개의 유전자를 가진다[18]. SFTSV를 진단하는 방법 중 SFTS 바이러스의 L, M 및 S 분절의 highly conserved region을 이용한 RT-PCR이 이용되며 SFTS 항체를 검사하는 효소면역검사법도 있다[19].

우리나라의 SFTS 확진에 대하여 발표한 자료에 의하면 SFTS는 전국에 걸쳐 발병하고 있으며 경기와 강원지역에 환자 발생률이 높았다. 환자 발생은 5월부터 11월 사이이며 2017년 경우 5월 2일 첫 환자가 발생하여 10월 79명으로 환자 발생이 증가하다가 11월에 3명으로 급격히 감소하였다. 겨울을 제외한 참진드기 활성 시기에는 환자가 지속적으로 발생하였다[20]. 관악산 등산로 및 서울대 교내 잔디밭에서는 273개체의 참진드기가 채집되었다. 종별, 성장단계별 SFTS바이러스 검사를 실시한 결과 작은소피참진드기 약충은 1.4%, 개피참진드기 약충은 8.1% 그리고 작은소피참진드기 유충에서는 2.0%의 감염률을 보였다[21]. 전북 고창에서는 채집된 진드기 중 참진드기 체내 SFTS 바이러스 검사를 실시한 총 347 pool에 대한 실험결과 8 pool에서 양성이 확인되어 0.15%의 감염률이 나타났다. 월별로는 5월에서 10월까지 8월을 제외한 매월 SFTS 바이러스 양성이 확인되었다[22]. 반면에 지리산 둘레길에서 채집한 진드기를 성숙단계 및 종별로 RT-PCR 방법을 이용하여 유전자 분석한 결과에서는 SFTS 바이러스가 나타나지 않았고 전남지역 곡성, 보성, 순천, 고흥에서 채집한 진드기에서도 SFTS 바이러스 양성은 확인되지 않았다[14]. 본 연구에서는 등산객이 주로 다니는 북한산 둘레길에서 참진드기 채집을 진행하여 채집된 진드기를 성숙단계별로 114회 pooling 하여 2× OneStep RT-PCR 방법으로 SFTS 바이러스 검사를 한 결과 양성은 나타나지 않았다.

2007년 9월 제주 둘레길이 개장되고 많은 사람들이 이용하면서 전국적으로 걷는 길에 대한 관심이 증가하여 중앙부처는 물론 각 지방 단체들이 걷고 싶은 길을 조성하고 있다. 2010년 8월 개장한 북한산 둘레길은 개장 100일 만에 155만여 명이 다녀 갈 정도로 이용객 수가 증가하였다[8]. 참진드기가 SFTS의 주된 매개체이긴 하나 이외에도 염소, 소, 양, 돼지, 개, 닭과 같은 가축에서 항체는 검출되고 감염증상은 나타나지 않아 보유숙주로 여겨지고 있다[23]. 북한산 둘레길에는 많은 민가들과 키우는 가축들이 있고 또한 온난화와 자연보호에 따른 야생동물의 증가와 더불어 반드시 흡혈을 해야 하는 참진드기 특성상 참진드기 개체수의 계속적인 증가가 예상되므로 둘레길에 대한 참진드기의 효율적인 예방관리 차원에서는 특정 지역, 특정 시기에 집중 관리가 필요하므로 세분화된 서식실태조사와 계절별 발생양상에 대한 지속적인 생태학적 자료수집이 이루어져야 할 것으로 사료한다.

요 약

2019년 4월부터 10월까지 북한산 둘레길 12구간(지축동), 14구간(울대리), 18구간(호원동)에서 참진드기를 채집해서 계절적 분포 조사와 매개체의 SFTS 바이러스 감염 여부를 확인하였다. 천젓기와 천끌기 방법으로 개피참진드기, 일본참진드기와 중증열성혈소판감소증후군의 주된 매개체로 알려진 작은소피참진드기 3종이 채집되었다. 작은소피참진드기는 채집비율이 지축동 91%, 울대리 94%, 호원동 98%를 차지하여 우점종이었다. 작은소피참진드기의 성숙단계에 따른 계절별 채집비율을 보면 성충의 경우 세 지역 모두 9월에 최고치를 보였고 약충의 경우에는 4월에서 6월 사이에 주로 채집되었다. 유충의 경우에는 9월과 10월에 최고치를 보였다. 채집된 작은소피참진드기 1,158개체를 성숙단계별로 2× OneStep RT-PCR과 nested PCR로 SFTS 바이러스 검사를 한 결과 양성은 나타나지 않았다. 2010년 개장 이후 이용객이 늘어나는 북한산 둘레길에서 기후 온난화로 증가가 예상되는 참진드기 매개 질환에 대한 위험분석과 효율적인 예방에 본 조사 결과가 활용될 수 있다.

References
  1. Sul H, Kim MD. Present state and future of tick-borne infectious diseases in Korea. J Korean Med Assoc. 2017;60:475-483. http://doi.org/10.5124/jkma.2017.60.6.475.
    CrossRef
  2. Kim KH, Oh MD. Severe fever with thrombocytopenia syndrome. Korean J Med. 2014;3:271-276. https://doi.org/10.3904/kjm.2014.86.3.271.
    CrossRef
  3. Ding F, Zhang W, Wang L, Hu W, Soares Magalhaes RJ, Sun HSun H, et al. Epidemiologic features of severe fever with thrombocytopenia syndrome in China, 2011-2012. Clin Infect Dis. 2013;56:1682-1683. https://doi.org/10.1093/cid/cit100.
    Pubmed CrossRef
  4. Takahashi T, Maeda K, Suzuki T, Ishido A, Shigeoka T, Tominaga TTominaga T, et al. The first identification and retrospective study of severe fever with thrombocytopenia syndrome in Japan. J Infect Dis. 2014;209:816-827. https://doi.org/10.1093/infdis/jit603.
    Pubmed KoreaMed CrossRef
  5. Zhang YZ, He YW, Dai YA, Xiong Y, Zang H, Zhou DJZhou DJ, et al. Hemorrhagic fever caused by a novel Bunyavirus in China: pathogenesis and correlates of fatal outcome. Clin Infect Dis. 2012;54:527-533. https://doi.org/10.1093/cid/cir804.
    Pubmed CrossRef
  6. Shin J, Kwon D, Youn SK, Park JH. Characteristics and factors associated with death among patients hospitalized for severe fever with thrombocytopenia syndrome, South Korea, 2013. Emerg Infect Dis. 2015;21:1704-1710. https://doi.org/10.3201/eid2110.141928.
    Pubmed KoreaMed CrossRef
  7. Noh BE, Lee WG, Lee HI, Cho SH. Geographical distribution of ticks in the Republic of Korea in 2018. Osong Public Health Res Perspect. 2018;11:1417-1421.
  8. Cho WH, Yun HJ, Im SB. A study on visitor satisfaction for Bukhansan Dulegil. J Korean Inst Landsc Archit. 2011;39:60-73. https://doi.org/10.9715/KILA.2011.39.4.060.
    CrossRef
  9. Yamaguti N, Tipton VJ, Keegan HL, Toshioka S. Ticks of Japan, Korea and the Ryukyu Islands. Brigham Young Univ Sci Bull. 1971;15:1-226.
  10. Egizi AM, Robbins RG, Beati L, Nava S, Evans CR, Occi JLOcci JL, et al. A pictorial key to differentiate the recently detected exotic Haemaphysalis longicornis Neumann, 1901 (Acari, Ixodidae) from native congeners in North America. Zookeys. 2019;818:117-128. https://zookeys.pensoft.net/article/30448.
    Pubmed KoreaMed CrossRef
  11. Yun SM, Lee WG, Ryou J, Yang SC, Park SW, Roh JYRoh JY, et al. Severe fever with thrombocytopenia syndrome virus in ticks collected from humans, South Korea, 2013. Emerg Infect Dis. 2014;20:1358-1361. https://doi.org/10.3201/eid2008.131857.
    Pubmed KoreaMed CrossRef
  12. Jung M, Kho JW, Lee WG, Roh JY, Lee DH. Seasonal occurrence of Haemaphysalis longicornis (Acari: Ixodidae) and Haemaphysalis flava, vectors of severe fever with thrombocytopenia syndrome (SFTS) in South Korea. J Med Entomol. 2019;56:1139-1144. https://doi.org/10.1093/jme/tjz033.
    Pubmed CrossRef
  13. Noh YT, Kim SY, Lee SH, Song BG. Molecular detection for tick-borne pathogens in hard ticks collected in Gangwon and Jeju-do, 2014. Osong Public Health Res Perspect. 2014;7:1071-1076.
  14. Song BJ, Lim HC, Ha TM, Jeon DY, Yang SI, Song HJ. Distribution of ticks carrying severe fever with thrombocytopenia syndrome virus (SFTSV) around Jiri walking trails of Jeollanam-do, Korea. Korean J Vet Serv. 2016;39:75-80. https://doi.org/10.7853/kjvs.2016.39.2.75.
    CrossRef
  15. Shin YC, Lee IY, Seo JH. Seasonal patterns of ticks in Pocheon and Chelwon, Republic of Korea. Korean J Clin Lab Sci. 2015;47:147-152. https://doi.org/10.15324/kjcls.2015.47.3.147.
    CrossRef
  16. KimJH, Seo CW, Kim EY, Lee DH. Infection control of severe fever with thrombocytopenia syndrome in hospital settings and comprehensive reviews of nosocomial infectious in South Korea. Osong Public Health Res Perspect. 2018;11:286-289.
  17. Kim DY, Kim DM. The most common mite and tick-borne infectious disease in Korea: Scrub typhus and severe fever thrombocytopenia syndrome. Korean J Med. 2018;93:416-423. https://doi.org/10.3904/kjm.2018.93.5.416.
    CrossRef
  18. Liu S, Chai C, Wang C, Amer S, Lv H, He HHe H, et al. Systematic review of severe fever with thrombocytopenia syndrome: virology, epidemiology, and clnical characteristics. Rev Med Virol. 2014;24:90-102. https://doi.org/10.1002/rmv.1776.
    Pubmed KoreaMed CrossRef
  19. Kim KH, Yi J, Kim G, Choi SJ, Jun KI, Kim NHKim NH, et al. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg Infect Dis. 2012;19:1892-1894. http://doi.org/10.3201/eid1911.130792.
    CrossRef
  20. Seo CW, KimJH, Kim EY, Lee SE, Park HK. Epidemiological characteristics of patients with severe fever with thrombocytopenia syndrome in Republic Korea in 2017. Osong Public Health Res Perspect. 2018;11:698-706.
  21. Chae JB, Kim TH, Jung JH, Park YJ, Park JH, Choi KSChoi KS, et al. Prevalence of severe fever with thrombocytopenia syndrome virus among ticks surveyed at Mt. Gwanak, Korea. Korean J Vet Res. 2017;57:169-174. https://doi.org/10.14405/kjvr.2017.57.3.169.
  22. Kim SY, Roh JY, Lee HS, Lim HW, Cho SH. Density and SFTS virus infection rates of ixodid in Gochang-gun, Jeollabuk-do, South Korea, 2016. Osong Public Health Res Perspect. 2017;10:1266-1270.
  23. Silvas JA, Aguilar PV. The emergence of severe fever with thrombocytopenia syndrome virus. Am J Trop Med Hyg. 2017;94:992-996. http://doi.org/10.4269/ajtmh.16-0967.
    Pubmed KoreaMed CrossRef

Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information
  • Shinhan University