search for   

 

Spreading of Aminoglycoside-Modifying Enzymes among Escherichia coli Isolated from Clinical Specimens in Chungcheong Province
Korean J Clin Lab Sci 2020;52:136-142  
Published on June 30, 2020
Copyright © 2020 Korean Society for Clinical Laboratory Science.

Ji Youn Sung1, Pil Seung Kwon2

1Department of Biomedical Laboratory Science, Far East University, Eumseong, Korea
2Department of Clinical Laboratory Science, Wonkwang Health Science University, Iksan, Korea
Correspondence to: Pil Seung Kwon
Department of Clinical Laboratory Science, Wonkwang Health Science University, 514 Iksan-daero, Iksan 54538, Korea
E-mail: pskwon@wu.ac.kr
ORCID: https://orcid.org/0000-0002-9808-4200
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
The antimicrobial resistance rate in bacteria has increased over the last several decades. The transfer of antimicrobial resistant determinants on mobile genetic elements could cause the accelerated emergence and spread of multidrug resistant bacteria. This study investigated the aminoglycoside resistance determinants transferred by mobile genetic elements in a total of 33 aminoglycoside non-susceptible E. coli isolated from clinical specimens in Chungcheong province. 16S ribosomal RNA methyl-transferases (RMTases) and aminoglycoside-modifying enzyme (AME) genes were detected via PCR and DNA sequencing. The most common AME genes were aac (3 ′)-II gene (54.5%), followed by aph (3 ′)-Ia (18.2%) and aac (6 ′)-Ib (15.2%). None of the evaluated RMTase genes were detected in the 33 isolates. Seventeen of the 18 isolates harboring aac (3 ′)-II gene were resistant to gentamicin, and 16 of them were resistant to tobramycin. The 5 isolates harboring aac (6 ′)-Ib gene were all resistant to tobramycin. In this study, we confirmed that one of the important mechanisms of aminoglycoside resistance in E. coli isolated from human is the acquisition of AME genes. Continuing investigations of antimicrobial resistant determinants in bacteria isolated from human may be required to prevent dissemination of antimicrobial resistant bacteria.
Keywords : aac (3 ′)-II gene, Aminoglycoside, Aminoglycoside-modifying enzyme, E . coli
서 론

항균제는 질병치료에 필수적인 요소지만 항균제가 도입됨과 동시에 감염병을 일으키는 세균들의 항균제에 대한 내성이 증가하여 내성세균에 의한 감염병 치료가 더욱 어려워졌다. 뿐만 아니라 항균제의 지속적인 사용으로 감염병을 일으키는 병원성 세균과 더불어 정상균무리에 속하며 사람과 동물의 장내에 주로 서식하는 장내세균까지 내성유전자를 획득하게 되었다. 이렇게 내성유전자를 획득한 정상균무리는 integrin, transposon 및 plasmid와 같은 mobile genetic element를 통해 병원성 세균에 내성유전자를 전달하는 reservoir역할을 하기도 하여 전 세계적으로 문제가 되고 있다[1-3].

세균 리보솜의 30S subunit에 결합함으로써 항균 작용을 하는 aminoglycoside는 임상적으로 유용한 항균제 중 하나로 그람음성 및 그람양성세균에 의한 감염병 치료를 위해 광범위하게 사용되어 왔다[4]. 그러나 항균제의 지속적인 사용으로 aminoglycoside에 내성을 나타내는 세균이 증가하게 되었고 감염병 치료를 위한 항균제의 선택에 어려움이 가중되었다. 세균이 이 항균제에 내성을 나타내는 기전 중 하나는 세균이 자신의 세포벽 합성에 관여하는 유전자를 변이시켜 aminoglycoside 같은 작은 분자가 세포 안으로 들어오지 못하도록 더욱 견고하게 장벽을 만들거나 일단 세포 안으로 들어온 aminoglycoside를 변이에 의해 더욱 강력해진 유출펌프로 세포 바깥으로 내보내는 것이다. 이러한 변이는 세균의 염색체 DNA에 발생하는 것으로 다른 세균으로 내성기전이 전달되기는 쉽지 않다[5].

Aminoglycoside에 대한 또 다른 내성기전은 세균이 aminoglycoside를 불활성화 시키는 효소인 aminoglycoside modifying enzymes (AMEs)를 생성하는 것인데, AMEs 생산은 E. coli, K. pneumoniae 및 많은 그람음성세균이 aminoglycoside에 내성을 나타내는 가장 중요한 기전 중 하나다. AMEs는 acetyltransferases (acetylation of an aminogroup-AAC), phosphotransferases (phosphorylationof a hydroxyl group-APH) 및 adenyltransferases (adenylation of a hydroxyl group-AAD or ANT)로 분류할 수 있는데 세균에 따라 하나 이상의 AMEs를 포함하고 있는 것도 있다. AME 유전자는 mobile genetic element를 통해 빠르게 확산될 수 있어 더 큰 문제가 되고 있다[4, 5]. 그리고 세균은 aminoglycoside가 결합하는 리보솜의 30S subunit에 변이를 만드는 16S ribosomal RNA methyltransferases (RMTases)를 생산하여 aminoglycoside가 리보솜에 결합하지 못하게 함으로써 내성을 나타내기도 한다. 그람음성세균에서 많이 발견되는 RMTase 유전자로는 armA, rmtA, rmtB, rmtC, rmtD, 및 npmA가 있다. 이 중 사람으로부터 분리된 장내세균에서 가장 빈번하게 발견되는 것은 armA, rmtB, 및 rmtC 유전자로 이들을 포함하고 있는 세균은 임상에서 주로 많이 사용하는 aminoglycoside에 고도내성(minimum inhibitory concentration [MIC] ≥128 mg/L)을 보인다[6, 7].

최근 임상검체에서 분리된 세균들이 aminoglycoside에 속하는 gentamycin을 비롯하여 여러 계열 항균제에 높은 내성을 보이고 있으나 aminoglycoside 내성기전에 대한 연구는 드물다. 본 연구에서는 충청지역에 위치한 병원에서 분리된 대장균을 대상으로 항균제에 대한 내성률을 조사하였고 aminoglycoside 내성기전을 분석하기 위해 AME 및 RMTase 유전자를 조사하였다. 본 연구는 aminoglycoside에 내성을 갖는 세균의 확산을 방지하기 위한 기초자료가 될 것으로 사료된다.

재료 및 방법

1. 균주의 수집 및 균종 동정

2017년 5월부터 9월까지 5개월 동안 충청지역에 위치한 일개의 대학병원에 의뢰된 임상검체(Clinical specimens, C)로부터 대장균 총 78균주가 수집되었다. 항균제 내성에 상관없이 각각의 검체로부터 균주를 분리된 순서대로 수집하였으며 동일대상에서 중복하여 분리된 균주는 수집대상에서 제외하였다. 각 검체로부터 분리배양된 균주의 동정은 Vitek 2 automated instrument ID system (bioMérieux, Marcy l'Etoile, France)을 이용하여 생화학적 방법으로 이루어졌다.

2. Aminoglycoside 내성 대장균 선별 및 항균제 감수성 시험

Aminoglycoside 항균제에 중간내성, 혹은 내성을 보이는 대장균을 선별하기 위해 분리배양된 대장균을 대상으로 Mueller-Hinton 한천배지(Difco, Cockeysville, MD, USA)를 사용하여 amikacin, gentamicin 및 tobramycin (Oxoid)에 대한 감수성을 Clinical and Laboratory Standards Institute (CLSI) 지침에 따라 디스크 확산법으로 확인하였다[8]. 그리고 amikacin, gentamicin 및 tobramycin 중 한가지 이상의 항균제에 내성을 보이거나 중간내성을 보이는 균주를 대상으로 ampicillin, cefotaxime, ciprofloxacin, levofloxacin, spectinomycin, streptomycin 및 trimethoprim (Oxoid)에 대한 항균제 감수성시험을 동일한 방법으로 시행하였다[8]. 정도관리를 위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을 동시에 시험하여 허용범위내에 있는지 확인하였다.

3. Aminoglycoside 내성인자 검출

Amikacin, gentamicin 및 tobramycin 중 한가지 이상의 항균제에 내성을 보이거나 중간내성을 보이는 균주를 대상으로 aminoglycoside 내성인자의 유전형을 조사하기 위해 기존의 시발체(Table 1)를 사용하여 PCR을 수행하였다[9, 10]. 대상균주로부터 DNA를 추출하기 위해 brain heart infusion broth (Difco)에 각각의 균주를 접종한 후 37°C에서 18시간 동안 배양하였다. DNA purification kit (Bioneer, Daejeon, Korea)을 사용하여 각 배양액으로부터 추출한 DNA를 PCR (polymerase chain reaction)의 주형으로 사용하였으며, PCR 반응용액(25 μL)은 AccuPower PCR PreMix (Bioneer)에 primer 각 10 pmol과 DNA 추출액(3 μL), 그리고 증류수를 혼합하여 만들었다. 각각의 PCR 반응용액을 GenePro Thermal Cycler B48D (Hangzhou Bioer Technology, China)를 사용하여 95°C에서 5분간 반응시킨 후, 95°C에서 30초, 50°C에서 30초, 72°C에서 40초씩 30회 증폭 반응시키고, 72°C에서 5분간 연장 반응시켰다. PCR purification kit (Bioneer)를 사용하여 증폭산물을 분리정제 한 후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA)와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를 이용하여 염기서열을 분석하였다. 확인된 염기서열을 NCBI에서 제공하는 BLAST 프로그램을 이용하여 각각의 참조 유전자와 비교 분석하였다.

Oligonucleotides used in present study for detection of aminoglycoside resistance determinants

Primer Sequence (5′–3′) Gene References
16S ribosomal RNA methyltransferases
armA-F CAAATGGATAAGAATGATGTT armA [9]
armA-R TTATTTCTGAAATCCACT
rmtA-F ATGAGCTTTGACGATGCCCTA rmtA [9]
rmtA-R TCACTTATTCCTTTTTATCATG
rmtB-F ATGAACATCAACGATGCCCT rmtB [9]
rmtB-R CCTTCTGATTGGCTTATCCA
rmtC-F CGAAGAAGTAACAGCCAAAG rmtC [9]
rmtC-R ATCCCAACATCTCTCCCACT
rmtD-F CGGCACGCGATTGGGAAGC rmtD [9]
rmtD-R CGGAAACGATGCGACGAT
rmtE-F ATGAATATTGATGAAATGGTTGC rmtE [9]
rmtE-R TGATTGATTTCCTCCGTTTTTG
rmtF-F GCGATACAGAAAACCGAAGG rmtF [9]
rmtF-R ACCAGTCGGCATAGTGCTTT
Aminoglycoside modifying enzyme gene detection
aac(3′)-Ia-F GACATAAGCCTGTTCGGTT aac(3′)-Ia [10]
aac(3′)-Ia-R TCCGAACTCACGACCGA
aac(3′)-II-F ATGCATACGCGGAAGGC aac(3′)-II [10]
aac(3′)-II-R TGCTGGCACGATCGGAG
aac(3′)-Ih-F TGCCGATATCTGAATC aac(3′)-Ih [10]
aac(3′)-Ih-R ACACCACACGTTCAG
aph(3′)-VI-F CGGAAACAGCGTTTTAGA aph(3′)-VI [10]
aph(3′)-VI-R TTCCTTTTGTCAGGTC
ant(2″)-Ia-F ATCTGCCGCTCTGGAT ant(3″)-Ia [10]
ant(2″)-Ia-R CGAGCCTGTAGGACT
aph(3′)-Ia-F CGAGCATCAAATGAAACTGC aph(3′)-Ia [10]
aph(3′)-Ia-R GCGTTGCCAATGATGTTACAG
aac(6′)-Ib-F TATGAGTGGCTAAATCGAT aac(3′)-Ib [10]
aac(6′)-Ib-R CCCGCTTTCTCGTAGCA

Abbreviations: F, forward (sense) primer; R, reverse (antisense) primer.


결 과

1. Aminoglycoside 내성 대장균의 분리

수집기간동안 임상검체로부터 대장균 총 78균주가 분리되었는데 이 중 33균주가 amikacin, gentamicin 및 tobramycin 중 한가지 이상의 항균제에 내성을 보이거나 중간내성을 보였다. 선별된 33균주는 amikacin, gentamicin 및 tobramycin 에 대한 항균제 감수성 양상이 다양하게 나타났는데 amikacin에 대해서는 33균주 중 27균주가 중간내성을 보였다.

2. 항균제 감수성 양상

수집기간동안 amikacin, gentamicin 및 tobramycin 중 한가지 이상의 항균제에 내성을 보이거나 중간내성을 보인 대장균 총 33균주가 분리되었다. 이 균주들의 항균제 내성률을 비교한 결과 ampicillin에 대한 내성률이 100%로 가장 높았으며 그 다음으로 streptomycin이 81.1%로 높았다(Table 2).

Antimicrobial susceptibilities of 33 E. coli strains isolated from clinical specimens

Antimicrobial agent No (%) of clinical specimens*

Susceptible Intermediate resistant Resistant
Amikacin 4 (12.1) 27 (81.8) 2 (6.1)
Gentamicin 14 (42.4) 2 (6.1) 17 (51.5)
Tobramycin 13 (39.4) 3 (9.01) 17 (51.5)
Spectinomycin 24 (72.7) 8 (24.2) 1 (3.0)
Streptomycin 0 (0.0) 6 (18.2) 27 (81.8)
Ampicillin 0 (0.0) 0 (0.0) 33 (100.0)
Cefotaxime 11 (33.3) 4 (12.1) 18 (54.5)
Levofloxacin 12 (36.4) 1 (3.0) 20 (60.6)
Ciprofloxacin 9 (27.3) 4 (12.1) 20 (60.6)
Trimethoprim 12 (36.4) 0 (0.0) 21 (63.6)

*The results were obtained from antimicrobial susceptibility tests were performed on 33 aminoglycoside non-susceptible E. coli isolated from clinical specimens in Chungcheong province.



3. Aminoglycoside 내성인자 검출 및 분석

1) RMTase 유전자 검출

Aminoglycoside계열 항균제에 내성 혹은 중간내성을 보인 33균주의 대장균을 대상으로 RMTase 유전자에 속하는 armA, rmtA, rmtB, rmtC, rmtD, rmtErmtF 유전자가 있는지를 조사하기 위해 PCR을 수행한 결과 양성반응을 보인 균주는 한 균주도 없었다.

2) Aminoglycoside-modifying Enzyme 유전자 검출

33균주의 선별된 대장균을 대상으로 AME 유전자인 aac(3′)-Ia, aac(3′)-II, aac(3′)-Ih, aph(3′)-VI, ant(2″)-Ia, aph(3′)-Iaaac(6′)-Ib 유전자의 존재여부를 조사하기위해 PCR을 수행한 결과 aac(3′)-II, aph(3′)-Ia 그리고 aac(6′)-Ib 유전자를 검출하기 위한 반응액에서 각각 18균주, 6균주, 5균주가 양성반응을 보였다(Figure 1). 그 외 aac(3′)-Ia, aac(3′)-Ih, aph(3′)-VIant(2″)-Ia 유전자를 확인하기 위한 반응액에서는 양성반응이 나타나지 않았다. 양성반응을 나타낸 aac(3′)-II, aph(3′)-Ia 그리고 aac(6′)-Ib 반응액으로부터 중폭된 PCR 생성물을 대상으로 분석한 염기서열을 참조유전자와 비교한 결과 유전자 염기서열이 각각 accession no. CP049082.1 (aac(3′)-II 유전자), CP049355.1 (aph(3′)-Ia 유전자) 그리고 NG_067948 (aac(6′)-Ib 유전자)과 각각 100% 일치하였다(Table 3). 본 연구에서 시험한 AME 유전자 중 가장 많은 빈도로 검출된 유전자는 aac(3′)-II 유전자로 18균주가 이 유전자를 포함하고 있었다. 그 다음 많은 빈도로 검출된 유전자는 aph(3′)-Ia 유전자로 6균주가 이 유전자를 포함하고 있었으며 aac(6′)-Ib 유전자는 포함하는 균주도 5균주가 있는 것으로 나타났다. 본 연구에서 분석 대상이었던 33균주 중 21균주가 AME 유전자를 한 개 이상 포함하고 있었는데 이들 중 19균주가 amikacin, gentamicin 및 tobramycin 중 한가지 이상의 항균제에 내성을 보인 것으로 나타났다. 그리고 AME 유전자를 포함하고 있는 21균주 중 2균주는 aac(3′)-II, aph(3′)-Iaaac(6′)-Ib 유전자 3종류를 모두 포함하고 있었는데 이들은 gentamicin과 tobramycin 뿐 만 아니라 amikacin에도 내성을 보였다.

Aminoglycoside resistance determinants of E. coli isolates involved in this study

Isolate Specimens Phenotype* Aminoglycoside-modifying Enzyme genes 16S ribosomal RNA methyltransferases
C1 Urine TOB aac(6′)-Ib
C2 Urine
C3 Sputum CN, TOB aac(3′)-II aac(6′)-Ib
C4 Blood aph(3′)-Ia
C5 Blood aph(3′)-Ia
C6 Urine CN, TOB aac(3′)-II
C7 Urine
C8 Urine CN, TOB aac(3′)-II
C9 Sputum CN, TOB aac(3′)-II aph(3′)-Ia
C10 Blood
C11 Urine
C12 Urine
C13 Urine CN, TOB aac(3′)-II
C14 Urine CN, TOB aac(3′)-II
C15 Urine CN, TOB aac(3′)-II
C16 Urine CN, TOB aac(3′)-II
C17 Urine CN, TOB aac(3′)-II
C18 Urine CN, TOB aac(3′)-II
C19 Urine
C20 Urine
C21 Urine CN, TOB aac(3′)-II
C22 Blood
C23 Urine CN, TOB aac(3′)-II aac(6′)-Ib
C24 Urine
C25 Urine
C26 Urine
C27 Pus CN aac(3′)-II
C28 Urine CN, TOB aac(3′)-II
C29 Urine
C30 Pus CN aac(3′)-II
C31 Pus TOB aac(3′)-II aph(3′)-Ia
C32 Urine AK, CN, TOB aac(3′)-II aph(3′)-Ia aac(6′)-Ib
C33 Urine AK, CN, TOB aac(3′)-II aph(3′)-Ia aac(6′)-Ib

Abbreviations: AK, amikacin; CN, gentamicin; TOB, tobramycin.

*Antimicrobial resistant phenotypes about aminoglycoside: amikacin; gentamicin and tobramycin.


Fig. 1. PCR band patterns of aminoglycoside resistance determinants. Lane M is 1 kb DNA size marker.
고 찰

그람음성세균이 RMTase 유전자를 포함할 경우 aminoglycoside에 고도내성을 보이게 되고 AMEs를 생산하는 것 또한 aminoglycoside에 내성을 나타내게 하는 중요한 인자라고 알려져 있다[11]. 이 유전자들은 mobile genetic element를 통해 다른 세균으로 전달될 수 있어 aminoglycoside 내성확산이란 측면에서 매우 중요한 인자들이다. 본 연구에서는 임상검체로부터 분리된 대장균을 대상으로 RMTase 및 AME 유전자를 조사했다.

연구기간 동안 수집된 대장균 총 33균주를 대상으로 항균제 감수성 시험을 한 결과 본 연구에서 조사된 항균제 중 amikacin을 제외한 aminoglycoside 계열 항균제(gentamicin, tobramycin 및 streptomycin)에 대해 50% 이상의 내성률을 보였다. 이 균주들을 대상으로 RMTase 유전자에 속하는 armA, rmtA, rmtB, rmtC, rmtD, rmtErmtF 유전자가 있는지를 조사한 결과 유전자를 포함한 균주는 한 균주도 없는 것으로 나타났다. 이 결과는 이전에 국내 임상검체로부터 분리된 대장균 398균주를 대상으로 RMTase 유전자의 존재유무를 조사한 결과와 유사한데 다른 그람음성간균 특히 52.4%의 Acinetobacter baumannii 가 RMTase 유전자를 포함하고 있는 것과는 대조적으로 대장균에서는 검출되지 않았다고 하였다[12]. Amikacin 또는 gentamicin에 내성 혹은 중간내성을 보인 대장균을 대상으로 한 외국 보고에서도 AME 유전자의 검출률은 높았던 반면 RMTase 유전자는 검출이 되지 않았다고 했다[13].

반면 수집된 대장균 33균주를 대상으로 AME 유전자를 조사한 결과 aac(3′)-II, aph(3′)-Ia 그리고 aac(6′)-Ib 유전자를 각각 18균주(54.5%), 6균주(18.2%), 5균주(15.2%)가 포함하고 있는 것으로 나타났다. 다른 나라에서도 유사한 보고들이 있었는데 이집트에서도 대장균에서 가장 빈번하게 검출되는 유전자는 aac(3′)-II 유전자로 조사대상 균의 40%가 포함하고 있었다고 했다. 그 다음으로 aac(6′)-Ib (30%) 및 aph(3′)-Ia (23.3%) 유전자가 많이 검출되었다고 하였다[14]. 또 aminoglycoside 내성 대장균을 대상으로 AME 유전자를 조사한 연구에서는 aac(6′)-Ib (34.3%) aph(3′)-Ia (29.5%), ant(2″)-Ia (27.6%), 그리고 aac(3)-IIa (21.9%) 순서로 빈번하게 검출되었다고 하였다[15]. Amikacin 또는 gentamicin에 내성 혹은 중간내성을 보인 대장균을 대상으로 한 보고에서는 aac(6′)-Ib (76.9%)와 aac(3)-IIa (70.7%) 유전자가 매우 높은 빈도로 검출되었고 aph(3′)-Ia (7.6%)와 ant(2″)-Ia 유전자도 적은 빈도지만 검출되었다고 한다[13]. 이는 나라마다 검체마다 약간씩 빈도의 차이는 있으나 공통적으로 빈번하게 검출되는 유전자는 본 연구에서 검출된 aac(3′)-II, aph(3′)-Ia 그리고 aac(6′)-Ib 유전자임을 확인할 수 있었다.

한편, 본 연구에서 검출된 AME 유전자를 포함한 세균들은 다양한 aminoglycoside계열 항균제에 내성을 나타내는데 aac(3′)-II 유전자는 gentamicin, netilmicin; sisomicin 및 tobramycin 내성에 관여하고 aph(3′)-Ia 유전자는 gentamicin 내성에 관여하며 aac(6′)-Ib 유전자는 amikacin, kanamycin, netilmicin, sisomicin 및 tobramycin 내성에 관여한다고 알려져 있다[5, 16]. 본 연구에서도 aac(3′)-II 유전자를 포함하고 있는 18균주 중 오직 한 균주만 제외하고 17균주가 gentamicin에 내성을 보였으며 이들 중 16균주가 tobramycin에 동시에 내성을 나타냈다. 또한 aac(6′)-Ib 유전자를 포함하고 있는 5균주도 모두 tobramycin에 내성을 나타냈으며 이 중 2균주는 amikacin에도 내성을 보였다(Table 3). 이 결과는 임상검체로부터 분리된 대장균이 aminoglycoside에 내성을 나타내는 요인으로 AMEs 생산이 중요한 역할을 하고 있음을 시사한다. 아울러 가축에서 분리된 aminoglycoside 내성 대장균을 대상으로 AME 유전자를 조사한 국내 보고에서는 aph(3′)-Ia (46%)가 가장 많은 빈도로 검출되었고 그 다음으로 aac3-IVa (34.5%), aac3-IIa (22.3%), aac(6′)-Ib (15.1%) 순이었다고 하였다[17]. 본 연구에서 검출된 AME 유전자 중 aac(3′)-IIaac(6′)-Ib 유전자는 가축에서도 공통적으로 빈번하게 검출된 유전자로 이는 사람과 가축 사이에 내성유전자가 공유될 가능성이 큼을 시사하며 지속적으로 항균제 내성인자를 사람에서 분리된 세균 뿐만 아니라 가축에서 분리된 세균에도 확대하여 조사해야 할 것으로 사료된다.

임상검체로부터 분리된 aminoglycoside 내성 대장균의 분리빈도가 지속적으로 증가하고 있으나 aminoglycoside 내성 기전을 조사한 연구는 상대적으로 많지 않았다. 본 연구에서는 임상검체에서 분리된 대장균을 대상으로 mobile genetic element를 통해 빠르게 확산될 수 있으며 aminoglycoside에 고도내성을 유발할 수 있는 RMTase와 AME 유전자의 빈도를 조사하였다. 그 결과 대장균의 경우 RMTase 보다는 AME 유전자의 획득에 의해 aminoglycoside에 내성을 나타냄을 확인할 수 있었다. 또한 검출된 AME 유전자 aac(3′)-II, aph(3′)-Ia 그리고 aac(6′)-Ib 유전자는 전세계적으로 빈번하게 보고되고 있어 이미 광범위하게 확산되었음을 확인할 수 있었다. 이러한 aminoglycoside 내성유전자 및 내성세균의 출현 및 확산은 aminoglycoside의 무분별한 사용으로 및 사용량의 지속적인 증가 때문인 것으로 사료되며 이를 방지하게 위해서는 항균제 사용량을 줄이고 지속적으로 항균제 내성인자의 모니터링을 해야 할 것이다.

요 약

세균의 항균제 내성율은 지난 몇십년 동안 지속적으로 상승하였으며 mobile genetic elements를 통한 항균제내성인자들의 전파는 다제내성세균의 출현 및 확산을 가중시켰다. 본연구에서는 임상검체에서 분리된 aminoglycoside에 비감수성 대장균 33주를 대상으로 mobile genetic elements를 통해 전파될 수 있는 aminoglycoside 내성인자를 조사하였다. 16S ribosomal RNA methyltransferases (RMTases)와 aminoglycoside-modifying enzyme (AME)유전자가 PCR과 DNA 염기서열분석을 통해 검출되었다. 그 결과 aac(3′)-II 유전자(54.5%)를 포함하고 있는 균주가 제일 많았으며 그 다음으로 aph(3′)-Ia 유전자(18.2%)가 많았고 aac(6′)-Ib 유전자(15.2%)를 포함하는 균주도 있었다. RMTase 유전자는 본 연구에서는 검출되지 않았다. aac(3′)-II 유전자를 포함하고 있는 18균주 중 17균주가 gentamicin에 내성을 보였으며 이중 16균주는 tobramycin에도 내성을 보였다. aac(6′)-Ib 유전자를 포함하고 있는 5균주는 모두 tobramycin에 내성을 보였다. 본 연구에서 AME 유전자를 획득하는 것은 사람에서 분리된 대장균이 aminoglycoside에 내성을 나타내는 중요한 기전 중 하나임이 확인되었다. 사람으로부터 분리된 세균을 대상으로 지속적으로 항균제 내성인자를 조사하는 것은 내성세균의 확산을 막는데 필요할 것으로 사료된다.

References
  1. Aarestrup FM, Wegener HC, Collignon P. Resistance in bacteria of the food chain: epidemiology and control strategies. Expert Rev Anti Infect Ther. 2008;6:733-750. https://doi.org/10.1586/14787210.6.5.733.
    Pubmed CrossRef
  2. Tadesse DA, Zhao S, Tong E, Ayers S, Singh A, Bartholomew MJBartholomew MJ, et al. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950-2002. Emerg Infect Dis. 2012;18:741-749. https://doi.org/10.3201/eid1805.111153.
    Pubmed KoreaMed CrossRef
  3. Wei Q, Hu Q, Li S, Lu H, Chen G, Shen BShen B, et al. A novel functional class 2 integron in clinical Proteus mirabilis isolates. J Antimicrob Chemother. 2014;69:973-976. https://doi.org/10.1093/jac/dkt456.
    Pubmed CrossRef
  4. Garneau-Tsodikova S, Labby KJ. Mechanisms of resistance to aminoglycoside antibiotics: overview and perspectives. Medchemcomm. 2016;7:11-27.
    Pubmed KoreaMed CrossRef
  5. Park YJ. Aminoglycoside resistance in Gram-negative bacilli. Korean J Clin Microbiol. 2009;12:57-61.
    CrossRef
  6. Wachino JI, Arakawa Y. Exogenously acquired 16S rRNA methyl-transferases found in aminoglycoside resistant pathogenic Gram-negative bacteria: an update. Drug Resist Updat. 2012;15:133-148. https://doi.org/10.1016/j.drup.2012.05.001.
    Pubmed CrossRef
  7. Kim HC, Jang J, Kim H, Kim Y, Lee K, Kim Y. Multiplex PCR for simultaneous detection of aminoglycoside resistance genes in Escherichia coli and Klebsiella pneumonia. Korean J Clin Lab Sci. 2012;44:155-165.
  8. CLSI. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. CLSI document M100-S20. Wayne, Pennsylvania: Clinical and Laboratory Standards Institute; 2010. p52-53.
  9. Hidalgo L, Hopkins KL, Gutierrez B, Ovejero CM, Shukla S, Douthwaite SDouthwaite S, et al. Association of the novel aminoglycoside resistance determinant RmtF with NDM carbapenemase in Enterobacteriaceae isolated in India and the UK. J Antimicrob Chemother. 2013;68:1543-1550. https://doi.org/10.1093/jac/dkt078.
    Pubmed CrossRef
  10. Akers KS, Chaney C, Barsoumian A, Beskius M, Zera W. Aminoglycoside resistance and susceptibility testing errors in Acinetobacter baumannii-calcoaceticus complex. J Clin Microbiol. 2010;48:1132-1138. https://doi.org/10.1128/JCM.02006-09.
    Pubmed KoreaMed CrossRef
  11. Ballaben AS, Andrade LN, Galetti R, Ferreira JC, McElheny CL, Mettus RTMettus RT, et al. Diversity of high-level aminoglycoside resistance mechanisms among gram-negative nosocomial pathogens in Brazil. Antimicrob Agents Chemother. 2018;62:E01550-18. https://doi.org/10.1128/AAC.01550-18.
    Pubmed KoreaMed CrossRef
  12. Shin KA, Hwang SY, Hong SB. Molecular characterization and prevalence of 16S ribosomal RNA methylase producing bacteria in amikacin resistant gram-negative bacilli isolated from clinical specimens. Biomed Sci Let. 2012;18:299-306.
  13. Cirit OS, Fernández-Martínez M, Yayla B, Martínez-Martínez L. Aminoglycoside resistance determinants in multiresistant Escherichia coli and Klebsiella pneumoniae clinical isolates from Turkish and Syrian patients. Acta Microbiol Immunol Hung. 2019;66:327-335. https://doi.org/10.1556/030.66.2019.005.
    Pubmed CrossRef
  14. Abo-State M, Saleh YE, Gharee HM. Prevalence and sequence of aminoglycosides modifying enzymes genes among E.coli and Klebsiella species isolated from Egyptian hospitals. J Radiat Res. 2018;11:408-415. https://doi.org/10.1016/j.jrras.2018.08.005.
    CrossRef
  15. Fernández-Martínez M, Miró E, Ortega A, Bou G, González-López JJ, Oliver AOliver A, et al. Molecular identification of aminoglycoside-modifying enzymes in clinical isolates of Escherichia coli resistant to amoxicillin/clavulanic acid isolated in Spain. Int J Antimicrob Agents. 2015;46:157-163. https://doi.org/10.1016/j.ijantimicag.2015.03.008.
    Pubmed CrossRef
  16. Lim J, Lee G, Choi Y, Kim J. An analysis of the antibiotic resistance genes of multi-drug resistant (MDR) Acinetobacter baumannii. Korean J Clin Lab Sci. 2016;48:217-224. http://doi.org/10.15324/kjcls.2016.48.3.217.
    CrossRef
  17. Belaynehe KM, Shin SW, P HT, Yoo HS. Occurrence of aminoglycoside-modifying enzymes among isolates of Escherichia coli exhibiting high levels of aminoglycoside resistance isolated from Korean cattle farms. FEMS Microbiol Lett. 2017;364:129. https://doi.org/10.1093/femsle/fnx129.
    Pubmed CrossRef

Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information