search for   

 

Non-hemolytic, Mucinous, Coagulase Negative MRSA Isolated from Urine
Korean J Clin Lab Sci 2019;51:260-264  
Published on June 30, 2019
Copyright © 2019 Korean Society for Clinical Laboratory Science.

Jae Soo Kim1, Qute Choi2, Bo Kyeung Jung3, Jong Wan Kim3, Ga Yeon Kim4,*

1Department of Laboratory Medicine, Dankook University Hospital, Cheonan, Korea,
2Department of Laboratory Medicine, Chungnam National University College of Medicine, Daejeon, Korea,
3Department of Laboratory Medicine, Dankook University College of Medicine, Cheonan, Korea,
4Department of Public Health, Dankook University Graduate School, Cheonan, Korea
Correspondence to: Ga Yeon Kim Department of Public Health, Dankook University Graduate School, Dandae-ro, Dongnam-gu, Cheonan 31116, Korea E-mail: sysnhj77@gmail.com
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

An 84-year-old woman presented to the emergency department with a chief complaint of pressure sores of the anus. She had a urine catheter when she showed pyuria three times but had no fever. A microscopic examination revealed many grapevine-like Gram positive strains and neutrophils. After 24 hours of urine culture on blood agar, non-hemolytic mucous colonies were found and further enlarged after 48 hours of culture. The capsules were identified after India ink stain. The catalase was positive, but the tube coagulase and latex coagulase were both negative. The S. aureus was identified by Vitek-2 and mass spectrometer Vitek MS V-3 IVD. The strain was confirmed by 16S rRNA gene sequencing and multilocus sequence typing (MLST). The phenotypically atypical MRSA found in the tube coagulase and latex coagulase were both negative. MRSA often show no beta hemolysis as in this case but are rarely latex coagulase-negative. We report a woman whose urine culture showed non-hemolytic, tube coagulase-negative, and latex coagulase-negative MRSA.

Keywords : Coagulase-negative MRSA, Latex coagulase-negative MRSA, Non-hemolytic MRSA
INTRODUCTION

Staphylococcus aureus (S. aureus) is classified into facultative anaerobic Gram-positive cocci which do not form spore. S. aureus is positive both for catalase and coagulase test. Coagulase-negative staphylococcus (CNS) is generally considered to be less pathogenic than S. aureus [1]. Meanwhile, the increased prevalence of methicillin resistant S. aureus (MRSA) resulting in increased antimicrobial resistance is difficult to treat [2, 3]. The S. aureus is the causative agent of many diseases such as skin infection, pneumonia, endocarditis and osteomyelitis. Some strains produce toxins that cause gastroenteritis, skin elasticity syndrome and toxic shock syndrome. It also causes food poisoning and is one of the most frequently isolated bacterias in patients [1]. The diagnosis is mostly based on Gram stain and culture [3, 4]. The methicillin resistance of S. aureus is caused by mecA gene which is transcripted to transformed penicillin binding protein (PBP 2a). Vancomycin is an acceptable treatment option for MRSA and the recent emergence of clinical isolates resistant to vancomycin has made control of S. aureus be difficult [5]. Newer agents such as linezolid, daptomycin, telavancin, and ceftaroline have received regulatory approval for MRSA control [6].

Here, we report the MRSA strain isolated from the urine which show unique characteristics [7-9]. The isolate was non-hemolytic, tube coagulase negative and latex coagulase negative MRSA strain.

CASE REPORT

The patient visited the emergency department on March 3, 2017. She was an 84-year-old woman with pressure sores of the anus. She was transferred from nursing hospital nearby and had dementia and the history of back surgery. She was with urine catheter when admitted and showed pyuria three times but had no fever. The urinalysis was performed; protein 2+, occult blood 3+, WBC 3+ and RBC: 10∼29/High Power Field (HPF), and WBC: >100/HPF on microscopic examination. The Gram stain was performed and a large number of Gram-positive cocci clusters and >25 WBCs (×1,000 magnification) on microscope were observed. The culture on blood agar and MacConkey agar was done following standard method using 0.001 mL disposable loops and incubated at 36°C in 5% CO2 for 24∼48 hours. In the blood agar medium, a strong mucinous colony with diameter of 2∼3 mm was observed above 105 CFU/mL. The mucus was further enlarged after 48 hours of incubation. We assessed the number of bacteria per 1 mL of urine. The catalase was positive but the tube coagulase and the latex coagulase were both negative (Figure 1). The capsules were confirmed by India ink stain (Figure 2). The bacterial identification and antibiotics susceptibility testing were performed using Vitek-2 (Biomerieux Clinical Diagnostic, France). The colony showed antibiotic resistance to penicillin (≥0.5) and oxacillin (≥4) and susceptibility to gentamicin (≤0.5) and vancomycin (≤0.5). The MRSA was identified by Vitek-2 and mass spectrometer Vitek MS V-3 IVD (Biomerieux Clinical Diagnostic, France). The 16S rRNA gene sequencing (Table 1, Figure 3) and Multilocus Sequence Typing (MLST) revealed S. aureus which is 99.9% agreement with the standard strain ATCC 29213 (Table 2, Figure 4). The patient was treated with vancomycin 15-20 mg/kg IV every 8∼12 hr and was discharged after culture-negative.

Primers used for 16S rRNA Sequencing

Primer nameSequence (5′-3′)
27FAGAGTTTGATCMTGGCTCAG
533FGTGCCAGCMGCCGCGGTAA
907RCCGTCAATTCCTTTRAGTTT
1492RCGGTTACCTTGTTACGACTT

Primers for Multilocus Sequence Typing (MLST)

GenePrimerSequence (5′-3′)
arcForwardTTGATTCACCAGCGCGTATTGTC
ReverseAGGTATCTGCTTCAATCAGCG
aroForwardATCGGAAATCCTATTTCACATTC
ReverseGGTGTTGTATTAATAACGATATC
glpForwardCTAGGAACTGCAATCTTAATCC
ReverseTGGTAAAATCGCATGTCCAATTC
gmkForwardATCGTTTTATCGGGACCATC
ReverseTCATTAACTACAACGTAATCGTA
ptaForwardGTTAAAATCGTATTACCTGAAGG
ReverseGACCCTTTTGTTGAAAAGCTTAA
tpiForwardTCGTTCATTCTGAACGTCGTGAA
ReverseTTTGCACCTTCTAACAATTGTAC
yqiForwardCAGCATACAGGACACCTATTGGC
ReverseCGTTGAGGAATCGATACTGGAAC

Fig. 1.

Non-hemolytic, mucinous, coagulase negative MRSA isolated from urine. (A) Non-hemolytic, mucinous MRSA colony. (B) Tube coagulase negative and (C) Latex coagulase negative MRSA.


Fig. 2.

The capsules of S. aureus were observed by india ink stain (×1000).


Fig. 3.

Bacterial identification using 16S rRNA sequencing. (A) Diagrammatic representation of 16S gene and relative primer positions. In addition to highly conserved primer binding sites, 16S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for identification of bacteria. (B) Part of sequencing electropherogram.


Fig. 4.

Multilocus sequence typing [MLST] analysis using PubMLST site (https://pubmlst.org/).


DISCUSSION

Many of the genes coding for extracellular toxins, enzymes, and cell surface proteins of S. aureus are regulated by a 510-nucleotide (nt) RNA molecule, RNAIII. These are controlled by a complex regulatory locus, an gene regulator (agr) [10-12], whose unique feature is control of the expression of its target genes by means of an RNA molecule (RNAIII) [13]. agr RNAIII acts as a positive regulator on genes which are preferentially expressed postexponentially, whereas protein A and coagulase are inhibited. The kinetics of protein A gene (spa) transcription has been investigated with agr and agr mutant strains [14] and shown to be inversely related to the level of RNAIII. RNAIII had a strict inhibitory effect on spa expression. The regulation of coa expression is different from that of spa, in that coagulase expression may be modulated both positively and negatively by the agr system according to the growth stage. Therefore, coagulase expression appears to be both positively and negatively modulated by an agr-dependent mechanism [15], and the agr-dependent repression effect on coa mRNA is most probably the result of a direct binding of RNAIII to coa mRNA [16].

We found phenotypically atypical MRSA in that tube coagulase and latex coagulase were both negative. The MRSA often show no beta-hemolysis like our case patient but rarely latex coagulase-negative. We emphasize the role of 16S rRNA gene sequencing and MLST to fully ensure correct species diagnosis especially when it shows ambiguous biochemical findings [17]. Here, we report a case of an 84-year-old woman whose urine culture showed non-hemolytic, tube coagulase-negative and latex coagulase-negative MRSA.

요 약

84세 여성이 항문까지 욕창이 번져 응급실에 내원하였다. 그녀는 근처의 요양기관에서 전원되었고, 입원시 소변 도뇨관을 달고 있었으며 열은 없었다. 그람염색에서 많은 수의 포도상구균과 >25의 호중구 (×1000배 렌즈)가 관찰되었다. 24시간 배양한 혈액한천배지에서 용혈이 없는 점액성의 집락이 관찰되었으며 배양 48시간에는 점액성이 더욱 확대되었다. India ink로 염색하여 협막의 모습을 관찰하였으며, 카타라제 양성, 라텍스법 혈액응고효소 음성, 시험관법 혈액응고효소 음성소견을 보였다. Vitek-2와 질량분석기인 Vitek MS V-3 IVD에서 S. aureus로 나타났으며, 16S rRNA 유전자 염기서열 분석 및 Multilocus sequencing typing (MLST)에서 S. aureus로 표준균주인 ATCC 29213과 99.9% 일치를 보였다.

본 증례는 용혈성이 없고, 점액성이 강하며, 라텍스법 혈액응고효소 음성, 시험관법 혈액응고효소 음성소견을 보이는 MRSA를 동정하여 이를 보고한다.

Acknowledgements

None

Conflict of interest

None

Author’s information (Position)

Kim JS1, M.T.; Choi Q2, M.D.; Jung BK3, M.D.; Kim JW3, M.D.; Kim GY4, Professor.

References
  1. Svec P, Vancanneyt M, Sedlácek I, Engelbeen K, Stetina V, Swings J, et al. Reclassification of Staphylococcus pulvereri Zakrzewska-Czerwinska et al 1995 as a later synonym of Staphylococcus vitulinus Webster et al. 1994. Int J Syst Evol Microbiol. 2004;54:2213-2215. https://doi.org/10.1099/ijs.0.63080-0.
    Pubmed CrossRef
  2. Kim KM, Yoo JH, Choi JH, Park ES, Kim SR, Kim SM, et al. The national surveillance results of nosocomial infections along with antimicrobial resistance in intensive care units of sixteen university hospitals in Korea, 2004. Korean J Nosocomial Infect Control. 2006;11:79-86.
  3. Araki M, Kariyama R, Monden K, Tsugawa M, Kumon H. Molecular epidemiological studies of Staphylococcus aureus in urinary tract infection. J Infect Chemother. 2002;8:168-174. https://doi.org/10.1007/s101560200029.
    Pubmed CrossRef
  4. Jones JW, Carter A, Ewings P, O'Boyle PJ. An MRSA outbreak in a urology ward and its association with Nd:YAG coagulation laser treatment of the prostate. J Hosp Infect. 1999;41:39-44. https://doi.org/10.1016/S0195-6701(99)90035-X.
    Pubmed CrossRef
  5. Moran GJ, Mount J. Staphylococcus aureus resistant to vancomycin—United States, 2002. Ann Emerg Med. 2003;41:148-151.
  6. Choo EJ. Antimicrobial therapy for methicillin-resistant Staphylococcus aureus. J Korean Med Assoc. 2018;61:207-213. https://doi.org/10.5124/jkma.2018.61.3.207.
    CrossRef
  7. Gilbert I. Dissociation in an encapsulated staphylococcus. J Bacteriol. 1931;21:157-160.
    Pubmed KoreaMed
  8. Yoshida K. Demonstration of serologically different capsular types among strains of Staphylococcus aureus by the serum-soft agar technique. Infect Immun. 1971;3:535-539.
    Pubmed KoreaMed
  9. Yoshida K, Smith MR, Naito Y. Biological and immunological properties of encapsulated strains of Staphylococcus aureus from human sources. Infect Immun. 1970;2:528-532.
    Pubmed KoreaMed
  10. Morfeldt E, Janzon L, Arvidson S, Lofdahl S. Cloning of a chromosomal locus (exp) which regulates the expression of several exoprotein genes in Staphylococcus aureus. Mol Gen Genet. 1988;211:435-440.
    Pubmed CrossRef
  11. Peng HL, Novick RP, Kreiswirth B, Kornblum J, Schlievert P. Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus. J Bacteriol. 1988;170:4365-4372.
    Pubmed KoreaMed CrossRef
  12. Recsei P, Kreiswirth B, Reilly MO, Schlievert P, Gruss A, Novick RP. Regulation of exoprotein gene expression in Staphylococcus aureus by agr. Mol. Gen. Genet. 1986;202:58-61.
    Pubmed CrossRef
  13. Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, Moghazeh S. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 1993;12:3967-3975.
    Pubmed KoreaMed CrossRef
  14. Vandenesch F, Kornblum J, Novick RP. A temporal signal, independent of agr is required for hla but not spa transcription in Staphylococcus aureus. J Bacteriol. 1991;173:6313-6320.
    Pubmed KoreaMed CrossRef
  15. Lebeau C, Vandenesch F, Greenland T, Novick RP, Etienne J. Coagulase expression in Staphylococcus aureus is positively and negatively modulated by an agr-dependent mechanism. J Bacteriol. 1994;17:5534-5536.
    Pubmed CrossRef
  16. Chevalier C, Boisset S, Romilly C, Masquida B, Fechter P, et al. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation. PLoS Pathog. 2010;6:E1000809. https://doi.org/10.1371/journal.ppat.1000809.
    Pubmed KoreaMed CrossRef
  17. Akineden Ö, Hassan AA, Schneider E, Usleber E. A coagulase-negative variant of Staphylococcus aureus from bovine mastitis milk. J Dairy Res. 2011;78:38-42. https://doi.org/10.1017/S0022029910000774.
    Pubmed CrossRef

Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information