search for   

 

Epidemiological Study of KPC-2 Producing Klebsiella pneumoniae Isolated in Daejeon During a 4-Year Period
Korean J Clin Lab Sci 2022;54:265-272  
Published on December 31, 2022
Copyright © 2022 Korean Society for Clinical Laboratory Science.

Hye Hyun Cho

Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, Daejeon, Korea
Correspondence to: Hye Hyun Cho
Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, 100 Hyechon-ro, Seo-gu, Daejeon 35408, Korea
E-mail: airplane1102@hanmail.net
ORCID: https://orcid.org/0000-0002-0471-4938
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
The emergence and dissemination of carbapenemase-producing Enterobacteriaceae (CPE), particularly the Klebsiella pneumoniae carbapenemase-2 (KPC-2) producing Klebsiella pneumoniae, has been rapidly increasing worldwide and is becoming a serious public health threat. Since the epidemiology and characteristics of these KPC-2-producing K. pneumoniae vary according to the region and period under consideration, this study investigated the prevalence of carbapenemases and the epidemiological relationship of 78 carbapenem-resistant K. pneumoniae (CRKP) isolated from a tertiary hospital in Daejeon, from March 2017 to December 2020. The antimicrobial susceptibility tests were identified using the disk-diffusion method. PCR and DNA sequencing were used to determine the carbapenemase genes. In addition, molecular epidemiology was performed by multilocus sequence typing (MLST). Among the 78 CRKP isolates, 35 isolates (44.9%) were carbapenemase-producing K. pneumoniae (CPKP) and the major carbapenemase type was KPC-2 (30 isolates, 85.7%). The New Delhi metallo-enzyme-1 (NDM-1) and NDM-5 were identified in 4 isolates (11.4%) and 1 isolate (2.9%), respectively. Multilocus sequence typing (MLST) analysis showed 10 sequence types (STs) and the most prevalent ST was ST307 (51.4%, 18/35). All the ST307 isolates were KPC-2-producing K. pneumoniae and were multidrug-resistant (MDR). In addition, ST307 has gradually emerged during a four-year period. These findings indicate that continuous monitoring and proper infection control are needed to prevent the spread of KPC-2-producing K. pneumoniae ST307.
Keywords : Beta-lactamase KPC-2, Carbapenemase, Klebsiella pneumoniae
서 론

베타락탐 (β-lactam) 항균제를 분해할 수 있는 TEM, SHV, CTX-M 등의 extended-spectrum β-lactamase (ESBL)를 생성하는 장내 세균이 확산됨에 따라, 광범위 치료 효과가 우수한 carbapenem이 ESBL 생성 장내 세균의 주요 항균제로 사용되었다[1]. 최근 들어 carbapenem의 사용이 증가하면서 전 세계적으로 carbapenem 내성 장내 세균(carbapenem-resistant Enterobacteriaceae, CRE)이 급속도로 증가하여 심각한 문제로 대두되고 있다[2, 3]. 이러한 CRE는 carbapenemase 비 생성 장내 세균(carbapenemase-nonproducing Entero-bacteriaceae, CNPE)과 carbapenemase 생성 장내 세균(carbapenemase-producing Enterobacteriaceae, CPE)으로 구분할 수 있다[4]. Carbapenemase 생성에 의한 항균제의 불활성화는 carbapenem 내성 획득의 주요 기전으로, plasmid와 transposon에 의한 동종 또는 이종 간 전파를 통해 carbapenem 내성 확산이 우려되고 있다[5].

1993년 NMC (not metalloenzyme carbapenemase)에 의한 CPE가 처음 보고된 이후, 다양한 CPE들이 확인되고 있으며, 그 발생 빈도가 증가하고 있다[2]. 국내의 경우, 질병관리청에 보고된 CPE의 분리 건수를 살펴보면, 2015년 565건, 2016년 1,453건, 2017년 2,657건으로 매년 급격하게 증가하는 추세를 보였다[6].

또한, 2012년 이후 보고된 CPE의 분리 균종은 K. pneumoniae가 가장 많이 분리되었고, 2015년 이후 보고된 CPE의 분해효소는 Klebsiella pneumoniae carbapenemase (KPC)가 가장 흔하였으며, KPC-2가 가장 큰 비율로 확인되었다. 국내에서 발표한 이전 연구에서도 CPE 중 KPC-2 생성 K. pneumoniae의 비율이 가장 높은 것으로 보고하였다[6-8]. 최근 유럽에서 발표한 연구에서 KPC 생성 K. pneumoniae의 colistin 내성률이 증가한다는 결과가 보고되었으며[9, 10], 국내 연구에서도 KPC 생성 K. pneumoniae를 포함한 대부분의 CPE가 다제 내성으로 보고되어 큰 우려를 낳고 있다[11, 12].

이러한 CPE의 빠른 전파 속도와 항균제 내성률 증가를 지속적으로 감시 및 관리하기 위해서는 기간, 지역, 의료기관 등의 특성에 따른 다양한 역학적 연구가 필요한 실정이다.

이에 본 연구에서는 4년 동안 대전지역의 3차 병원에서 분리된 carbapenem 내성 K. pneumoniae를 대상으로 carbapenemase 유전자를 분석하고, 이에 대한 항균제 내성 및 역학관계에 대해 조사하고자 한다.

재료 및 방법

1. 균주의 수집과 동정

본 연구는 2017년 3월부터 2020년 12월까지 대전지역의 3차 병원에서 분리된 carbapenem 내성 K. pneumoniae (carbapenem-resistant K. pneumoniae, CRKP) 78 균주를 대상으로 하였다. 이 중 동일 환자에서 반복 분리된 균주는 수집대상에서 제외하였다. 임상 검체로부터 분리 배양된 균주는 Vitek 2 automated ID system (BioMerieux, Hazelwood, MO, USA)을 이용하여 동정하였고, CRKP는 ertapenem, imipenem 및 meropenem에 내성인 균주로 선별하였다.

2. 항균제 감수성 검사

Clinical and laboratory standards institute (CLSI) 지침에 따라[13], amikacin, gentamicin, ertapenem, imipenem, meropenem, ceftazidime, cefotaxime, cefepime, cipro-floxacin, trimethoprim/sulfamethoxazole, chloram-phenicol, tigecycline (BioMerieux)에 대한 항균제 감수성 검사는 Mueller-Hinton 한천 배지(Difco, Cockeysville, MD, USA)를 사용하여 디스크 확산법으로 확인하였다. 정도관리를 위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을 동시에 시험하여 허용범위 내에 있는지 확인하였다.

3. Carbapenemase의 검출

CRKP 78 균주를 대상으로 carbapenemase 생성 여부를 확인하기 위해 이전 연구에서 사용한 primer (Table 1)를 이용하여 PCR을 수행하였다[14]. 먼저, 대상 균주는 brain heart infusion broth (Difco)에 접종하여 37℃에서 24시간 배양한 후, Genomic DNA Prep Kit (Solgent, Daejeon, Korea)를 사용하여 DNA를 추출하였다. DNA 추출액(5 μL), 10× Taq buffer (2.5 μL), 10 mM dNTP mix (0.5 μL), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및 증류수를 혼합하여 총 부피 25 μL의 반응 용액을 만들었다. PCR 과정은 94℃에서 10분간 반응시킨 후, 94℃에서 30초, 52℃에서 40초, 72℃에서 50초로 36회 증폭 반응시키고, 72℃에서 5분간 연장 반응시켰다. 각 PCR 반응 산물은 ethidium bromide가 포함된 1% agarose gel에서 30분간 전기영동한 후 밴드를 확인하였다. 증폭산물은 PCR purification kit (Solgent)로 분리한 후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA)와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를 이용하여 염기서열을 분석하였다. 각각의 염기서열 분석 결과는 NCBI에서 제공하는 BLAST 프로그램을 이용하여 Escherichia coli ATCC 25922와 비교 분석하였다.

Oligonucleotides primers used in current study

Genes Sequence (5’-3’) Annealing temperature (℃) Product size (bp) References
Carbapenemase gene primers
blaIMP F: GGAATAGAGTGGCTTAAYTCTC 52 232 [14]
R: GGTTTAAYAAAACAACCACC
blaVIM F: GATGGTGTTTGGTCGCATA 52 390 [14]
R: CGAATGCGCAGCACCAG
blaOXA-48 F: GCGTGGTTAAGGATGAACAC 52 438 [14]
R: CATCAAGTTCAACCCAACCG
blaNDM F: GGTTTGGCGATCTGGTTTTC 52 621 [14]
R: CGGAATGGCTCATCACGATC
blaKPC F: CGTCTAGTTCTGCTGTCTTG 52 798 [14]
R: CTTGTCATCCTTGTTAGGCG
MLST gene primers
rpoB F: GGCGAAATGGCWGAGAACCA 50 501 [15]
R: GAGTCTTCGAAGTTGTAACC
gapA F: TGAAATATGACTCCACTCACGG 60 450 [15]
R: CTTCAGAAGCGGCTTTGATGGCTT
mdh F: CCCAACTCGCTTCAGGTTCAG 50 477 [15]
R: CCGTTTTTCCCCAGCAGCAG
pgi F: GAGAAAAACCTGCCTGTACTGCTGGC 50 432 [15]
R: CGCGCCACGCTTTATAGCGGTTAAT
phoE F: ACCTACCGCAACACCGACTTCTTCGG 50 420 [15]
R: TGATCAGAACTGGTAGGTGAT
infB F: CTCGCTGCTGGACTATATTCG 50 318 [15]
R: CGCTTTCAGCTCAAGAACTTC
tonB F: CTTTATACCTCGGTACATCAGGTT 45 414 [15]
R: ATTCGCCGGCTGRGCRGAGAG

Abbreviation: MLST, multilocus sequence typing.



4. MLST 분석

MLST는 Klebsiella pneumoniae MLST database website (https://bigsdb.pasteur.fr/klebsiella/)에 설명된 방법에 따라 분석하였다. 앞서 Carbapenemase의 검출과 동일한 방법으로, DNA 추출액(5 μL), 10× Taq buffer (2.5 μL), 10 mM dNTP mix (0.5 μL), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및 증류수를 혼합하여 총 부피 25 μL의 반응 용액을 만들었다. 7개의 housekeeping gene (rpoB, gapA, mdh, pgi, phoE, infB, tonB)은 Gene Amp PCR System 9600 (Perkin-Elmer, Norwalk, CT, USA)을 사용하여 94℃에서 2분간 반응시킨 후, 95℃에서 20초, 50℃ (60℃ 또는 45℃)에서 30초, 72℃에서 30초로 35회 증폭 반응시키고, 72℃에서 5분간 연장 반응시켰다(Table 1) [15]. 각각의 PCR 반응 산물은 ethidium bromide가 포함된 1% agarose gel에서 30분간 전기영동 하여 밴드를 확인하였다. 증폭산물은 PCR purification kit (Solgent)로 분리한 후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems)와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를 이용하여 염기서열을 분석하였다. 7개의 housekeeping gene에 대한 각각의 염기서열 분석 결과는 MLST database에 입력하여 allelic number와 sequence type (ST)을 확인하였다.

결 과

1. Carbapenemase의 확인 및 분석

Carbapenemase 유전자의 검출을 위해 PCR과 염기서열을 분석한 결과, 총 78 균주의 CRKP 중 35 균주(44.9%)가 carbapenemase-producing K. pneumoniae (CPKP)로 확인되었다. 이 중 30 균주(85.7%)는 KPC-2가 확인되었고, 4 균주(11.4%)는 NDM-1이 확인되었으며, 1 균주(2.9%)는 NDM-5가 확인되었다. 또한, CPKP 35 균주의 연도별 발생 빈도를 살펴보면, 2017년 14.3% (5 균주), 2018년 20.0% (7 균주), 2019년 28.6% (10 균주), 2020년 37.1% (13 균주)로 4년 동안 점진적인 증가 추세를 보였다.

2. CPKP의 MLST 분석

총 35 균주의 CPKP를 대상으로 MLST를 시행한 결과, 총 10개의 ST를 확인하였다(Table 2). 10개의 ST 중 가장 흔한 유형은 ST307이었고, 총 35 균주 중 18 균주(51.4%)에서 확인되었다. 그다음으로 ST789가 4 균주(11.4%)에서 확인되었으며, ST48과 ST147이 각각 3 균주(8.6%), ST11이 2 균주(5.7%)에서 확인되었다. 나머지 5개의 ST (ST25, ST337, ST395, ST714, ST1944)는 각각 1 균주(2.9%)에서 확인되었다.

MLST analysis of 35 carbapenemase-producing Klebsiella pneumoniae

ST Allelic profile No. of isolates
(%)
rpoB gapA mdh pgi phoE infB tonB
307 1 4 2 52 1 1 7 18 (51.4)
789 1 25 1 1 20 10 22 4 (11.4)
48 1 2 2 2 7 5 10 3 (8.6)
147 4 3 6 1 7 4 38 3 (8.6)
11 1 3 1 1 1 3 4 2 (5.7)
25 4 2 1 1 10 1 13 1 (2.9)
337 1 2 11 1 1 1 13 1 (2.9)
395 1 3 2 4 1 1 4 1 (2.9)
714 4 2 2 2 6 3 160 1 (2.9)
1944 115 2 1 6 9 1 182 1 (2.9)

Abbreviation: ST, sequence type.



연도별 확인된 ST의 유형을 살펴보면, 2017년과 2018년에 각각 4개의 ST가 분포하였고, 이 중 3개의 ST (ST307, ST789, ST11)가 동일하게 확인되었다(Table 3). 2019년에는 2개의 ST가 분포하였고, 2020년에는 5개의 ST가 확인되었다. 2017년부터 2020년까지 4년 동안 지속적으로 확인된 ST 유형은 ST307이었고, 2017년을 제외한 2018년 42.9% (총 7 균주 중 3 균주), 2019년 70.0% (총 10 균주 중 7 균주), 2020년 53.8% (총 13 균주 중 7 균주)로, 연도별 분포한 ST 중 가장 높은 비율로 확인되었다.

Prevalence of ST based on year in 35 CPKP isolates collected during a four-years periods

Years No. of isolates (%) ST (N)
2017 5 (14.3) 789 (2), 337 (1), 307 (1), 11 (1)
2018 7 (20.0) 307 (3), 789 (2), 395 (1), 11 (1)
2019 10 (28.6) 307 (7), 48 (3)
2020 13 (37.1) 307 (7), 147 (3), 1944 (1), 714 (1), 25 (1)

Abbreviation: ST, sequence type.



임상 검체의 종류에 따라 CPKP 35 균주를 분리한 결과, 21 균주(60.0%)가 대변(직장 도말 검체 포함)에서 가장 많이 분리되었으며, 7개의 ST가 확인되었다(Table 4). 이 중 ST307이 15 균주(71.4%)로 가장 높은 비율로 확인되었으며, 나머지 6개의 ST (ST48, ST147, ST337, ST714, ST781, ST1944)가 각각 1 균주(4.8%)로 확인되었다. 다음으로 CPKP 35 균주 중 6 균주(17.1%)가 소변에서 분리되었으며, 4개의 ST가 확인되었다. ST789가 3 균주(50.0%)에서 확인되었으며, ST11, ST147, ST307이 각각 1 균주(16.7%)에서 확인되었다. 객담에서 분리된 5 균주(14.3%)는 4개의 ST가 확인되었으며, 이 중 ST48이 2 균주(40.0%)에서 확인되었고, ST11, ST25, ST147이 각각 1 균주(20.0%)에서 확인되었다. 담즙에서 분리된 2 균주(5.7%)는 모두 ST307로 확인되었고, 혈액에서 분리된 1 균주(2.9%)는 ST395로 확인되었다.

Prevalence of ST based on specimen in 35 CPKP isolates

Specimens No. of isolates (%) ST (N)
Stool 21 (60.0) 307 (15), 48 (1), 147 (1), 337 (1), 714 (1), 789 (1), 1944 (1)
Urine 6 (17.1) 789 (3), 11 (1), 147 (1), 307 (1)
Sputum 5 (14.3) 48 (2), 11 (1), 25 (1), 147 (1)
Bile 2 (5.7) 307 (2)
Blood 1 (2.9) 395 (1)

Abbreviation: ST, sequence type.



Carbapenemase 생성에 따른 ST의 유형을 분석한 결과, KPC-2가 확인된 30 균주는 7개의 ST가 확인되었고, 이 중 ST307이 18 균주(60.0%)로 가장 높은 비율로 분포하였다(Table 5). 순차적으로 ST789가 4 균주(13.3%), ST48이 3 균주(10.0%), ST11이 2 균주(6.7%)로 분포하였고, ST25, ST337, ST395에서 각각 1 균주(3.3%)로 분포하였다. NDM-1이 확인된 4 균주는 2개의 ST가 확인되었는데, 이 중 ST147이 3 균주(75.0%)로 높은 비율을 차지하였으며, ST714가 1 균주(25.0%)로 분포하였다. NDM-5가 확인된 1 균주는 ST1944에서 분포하였다.

Prevalence of ST based on carbapenemase in 35 CPKP isolates

Carbapenemase No. of isolates (%) ST (N)
KPC-2 30 (85.7) 307 (18), 789 (4), 48 (3), 11 (2), 25 (1), 337 (1), 395 (1)
NDM-1 4 (11.4) 147 (3), 714 (1)
NDM-5 1 (2.9) 1944 (1)

Abbreviation: ST, sequence type.



3. 항균제 감수성 양상 확인

총 35 균주의 CPKP를 대상으로 항균제 감수성 검사를 실시한 결과, ertapenem, imipenem, meropenem, ceftazidime, cefotaxime에 35 균주(100%) 모두 내성을 보였으며, cefepime, ciprofloxacin에 94.3% (33 균주)의 높은 내성을 보였다(Table 6). 또한, 순차적으로 trimethoprim/sulfamethoxazole에 85.7% (30 균주), chloramphenicol에 60.0% (21 균주), gentamicin에 51.4% (18 균주)의 내성을 보였고, tigecycline은 22.9% (8 균주)의 비교적 낮은 내성을 보였으며, amikacin은 2.9% (1 균주)의 매우 낮은 내성을 보였다.

Antimicrobial susceptibility pattern of 35 CPKP isolates according to ST

ST No. of isolates AMK GEN ETP IPM MPM CAZ CTX FEP CIP TMP/SMX CHL TGC
S I R S I R S I R S I R S I R S I R S I R S I R S I R S I R S I R S I R
307 18 17 0 1 4 1 13 0 0 18 0 0 18 0 0 18 0 0 18 0 0 18 0 0 18 0 0 18 0 0 18 3 7 8 6 5 7
789 4 4 0 0 4 0 0 0 0 4 0 0 4 0 0 4 0 0 4 0 0 4 0 0 4 0 0 4 0 0 4 0 1 3 2 2 0
48 3 3 0 0 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 3 0 0 0 0 3 3 0 0
147 3 3 0 0 3 0 0 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 0 0 3 1 0 2 2 1 0
11 2 2 0 0 1 0 1 0 0 2 0 0 2 0 0 2 0 0 2 0 0 2 0 1 1 0 0 2 1 0 1 1 0 1 1 1 0
25 1 1 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1
337 1 1 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 1 0 0
395 1 1 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0
714 1 1 0 0 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 1 0 0 1 0 0 1 0 0 1 0 0
1944 1 1 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 1 0 0 0 0 1 0 0 1 1 0 0
Total 35 34 0 1 16 1 18 0 0 35 0 0 35 0 0 35 0 0 35 0 0 35 0 2 33 2 0 33 5 0 30 6 8 21 17 10 8

Abbreviations: ST, sequence type; AMK, amikacin; GEN, gentamicin; ETP, ertapenem; IPM, imipenem; MEM, meropenem; CAZ, ceftazidime; CTX, cefotaxime; FEP, cefepime; CIP, ciprofloxacin; TMP/SMX, trimethoprim/sulfamethoxazole; CHL, chloramphenicol; TGC, tigecycline; S, susceptible; I, intermediate resistant; R, resistant.



18 균주의 ST307은 12종의 항균제 중 8종(ertapenem, imipenem, meropenem, ceftazidime, cefotaxime, cefe-pime, ciprofloxacin, trimethoprim/sulfamethoxazole)에 대해 모두 내성임을 확인하였다. ST307은 amikacin에 내성을 보인 1 균주로 확인되었으며, tigecycline에 내성을 보인 총 8 균주 중 87.5% (7 균주)로 확인되었다. 또한, gentamicin에 내성을 보인 총 18 균주 중 72.2% (13 균주)로 확인되었으며, chloramphenicol에 내성인 21 균주의 38.1% (8 균주)로 확인되었다.

고 찰

전 세계적으로 CPE의 출현과 발생 빈도가 증가함에 따라 환자 치료와 감염 관리에 심각한 우려를 낳고 있다. 국내의 경우, CPE는 원내 감염 및 지역 사회의 항균제 내성 전파에 관여하는 주요 다제 내성균 중 하나이고, 지속적 증가 추세를 보이고 있어, 이에 대한 적극적인 감시와 철저한 감염 관리가 요구되는 실정이다.

본 연구에서 최근 4년 동안 대전지역의 3차 병원에서 분리된 CRKP 중 CPKP는 44.9% (35/78)로 확인되었으며, 이 중 KPC-2 생성 K. pneumoniae가 85.7% (30/35)로 가장 높은 비율을 차지하였다. 이러한 결과는 Ahn 등(2016)의 연구와 Hong 등(2020)의 연구에서 CPE 중 KPC 생성 K. pneumoniae가 가장 높은 비율로 확인된 것과 일치하였다[11, 12]. KPC 생성 CPE는 1990년대 후반부터 분리되기 시작하였고, KPC 생성 K. pneumoniae는 2000년대 중반부터 유럽에 전파되면서 일부 지역에 토착화되고 있으며, 환자의 사망률을 유의하게 증가시키는 주요 원인으로 보고되고 있다[9, 10, 16]. 국내에서도 CPE 중 KPC가 가장 흔하게 확인되었으며, 2010년 K. pneumoniae에서 처음으로 KPC-2가 확인된 이후 가장 많이 보고되고 있다[7, 17, 18].

또한, NDM-1 생성 K. pneumoniae가 11.4% (4/35), NDM-5 생성 K. pneumoniae가 2.9% (1/35)로 확인되었다. KPC 생성 K. pneumoniae는 브라질, 아르헨티나, 폴란드, 독일, 프랑스, 스페인, 중국에서 보고되는 반면, NDM 생성 K. pneumoniae는 캐나다, 그리스, 벨기에, 스웨덴, 노르웨이, 인도, 파키스탄, 중국에서 매우 우세하게 보고되고 있다[2, 19].

역학관계 확인을 위해 CPKP 35 균주를 대상으로 MLST를 실시한 결과, ST307이 51.4% (18/35)로 가장 흔한 유형으로 확인되었다. ST307은 2017년부터 2020년까지 4년 동안 지속적으로 분포하였고, 모두 KPC-2 생성 K. pneumoniae로 확인되었으며, 항균제 감수성 검사 결과, 다제 내성으로 확인되었다.

ST307은 전 세계적으로 우세한 주요 클론 중 하나로, 이탈리아, 한국, 미국, 멕시코, 중국 등에서 보고되고 있으며, fluoroquinolone, 제3세대 cephalosporin, carbapenem 계열 항균제에 대한 높은 내성과 관련하여 고위험 병원균으로 보고되고 있다[8, 20-23]. Yoon 등의 연구에 의하면, 2009년 국내에서 처음으로 확인된 KPC 생성 K. pneumoniae는 ST258으로 확인되었으나, 2014년 이후 KPC 생성 K. pneumoniae의 출현과 확산이 급증하였고, 주요 클론은 ST11과 ST307이 확인되었음을 보고하였다[8].

본 연구에서 CPKP 35 균주 중 두 번째로 흔한 ST 유형은 11.4% (4/35)로 확인된 ST789로, 모두 KPC-2 생성 K. pneumoniae로 확인되었다. 이와 달리, 2021년 중국에서 발표한 Wei 등의 연구에서는 ST789가 신생아 감염에서 확인된 NDM-5 생성 K. pneumoniae로 보고하였고, 새로운 고위험 ST 유형으로 분류하였다[24].

또한, 세 번째로 흔한 ST48과 ST147은 각각 8.6%를 차지하였다. 흥미롭게도, ST48은 2019년에 3 균주가 분포하였고, 모두 KPC-2 생성 K. pneumoniae로 확인된 반면, ST147은 2020년에 3 균주가 분포하였고, 모두 NDM-1 생성 K. pneumoniae로 확인되었다. 2019년 중국에서 KPC-2 생성 K. pneumoniae ST48의 확산을 처음 보고한 Gu 등은 ST48이 한국과 태국에서 주로 보고되고 있으며, 이들 중 일부가 tigecycline에 대한 내성을 보임에 따라, 세심한 주의가 필요한 잠재적 고위험 클론임을 입증하였다[25]. 또한, ST147은 최근 폴란드, 이란, 파키스탄, 미국 등에서 발표한 연구에서 NDM-1 생성 K. pneumoniae로 보고되고 있다[26-28].

네 번째로 5.7%를 차지한 ST11은 전 세계적으로 가장 널리 전파된 ST258의 single locus variant로, 유럽 전역과 아시아, 라틴 아메리카에서 주요 클론으로 보고되고 있다[5, 29]. 2014년 브라질에서 발표한 Andrade 등의 연구에 의하면, ST11에서 집락화, 생물막 형성 및 식균 작용 방어에 관여하는 많은 독성 인자와 다제 내성이 확인됨에 따라, 전 세계적으로 ST11의 클론 확산에 대한 우려를 보고하였다[30]. 그밖에 확인된 ST25, ST337, ST395, ST714, ST1944 또한 향후 국내 고위험 주요 클론으로 발전할 가능성이 높으므로, 이에 대한 추적 관찰 연구가 요구된다.

본 연구에서는 2017년부터 2020년까지, 대전지역의 3차 병원에서 분리된 CRKP를 대상으로 역학조사를 실시한 결과, 4년 동안 다제 내성 ST307이 확인되었고, 모두 KPC-2를 생성하는 것으로 확인되어, 전 세계적으로 우세한 클론의 국내 확산 및 정착화가 심각하게 우려되고 있다. 이러한 CPE의 확산을 방지하기 위해 지속적인 감시와 적절한 감염관리가 필요할 것으로 사료된다.

요 약

Carbapenemase 생성 장내 세균(carbapenemase-pro-ducing Enterobacteriaceae, CPE) 중 특히 KPC-2 생성 Klebsiella pneumoniae의 출현과 확산은 전 세계적으로 급격히 증가하고 있으며, 심각한 공중 보건 위협이 되고 있다. 이러한 KPC-2 생성 K. pneumoniae의 역학과 특징은 지역 및 기간에 따라 다르기 때문에, 본 연구에서는 2017년 3월부터 2020년 12월까지 대전지역의 3차 병원에서 분리된 carbapenem 내성 K. pneumoniae (carbapenem-resistant K. pneumoniae, CRKP) 78 균주를 대상으로 carbapenemase 유전자를 분석하고, 이에 대한 역학 관계를 조사하였다. 항균제 감수성 양상은 디스크 확산법으로 확인하였고, carbapenemase 유전자의 분석을 위해 PCR과 DNA 염기서열분석을 수행하였다. 또한, 역학관계는 MLST (multilocus sequence typing)를 통해 조사하였다.

78 균주의 CRKP 중 35 균주(44.9%)가 carbapenemase 생성 K. pneumoniae였으며, 주요 carbapenemase 유형은 KPC-2 (30주, 85.7%)로 확인되었다. NDM-1과 NDM-5는 각각 4 균주(11.4%)와 1 균주(2.9%)에서 확인되었다. MLST 분석에서 10개의 sequence type (ST)이 확인되었고, 가장 흔한 ST는 ST307 (51.4%, 18/35)이었다. ST307 균주는 모두 KPC-2 생성 K. pneumonia였고, 다제내성으로 확인되었다. 또한, ST307은 4년 동안 지속적으로 출현하였다. 이러한 결과는 KPC-2 생성 K. pneumoniae ST307의 확산을 방지하기 위해 지속적인 모니터링과 적절한 감염 관리가 필요할 것으로 사료된다.

Acknowledgements

This paper was supported by academic research fund offered from Daejeon Institute of Science and Technology in 2022.

Conflict of interest

None

Author’s information (Position)

Cho HH, Professor.

References
  1. Pitout JD. Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae: changing epidemiology and drug treatment choices. Drugs. 2010;70:313-333. https://doi.org/10.2165/11533040-000000000-00000.
    Pubmed CrossRef
  2. Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17:1791-1798. https://doi.org/10.3201/eid1710.110655.
    Pubmed KoreaMed CrossRef
  3. Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrob Agents Chemother. 2011;55:4943-4960. https://doi.org/10.1128/AAC.00296-11.
    Pubmed KoreaMed CrossRef
  4. Iovleva A, Doi Y. Carbapenem-resistant Enterobacteriaceae. Clin Lab Med. 2017;37:303-315. https://doi.org/10.1016/j.cll.2017.01.005.
    Pubmed KoreaMed CrossRef
  5. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009;9:228-236. https://doi.org/10.1016/S1473-3099(09)70054-4.
    Pubmed CrossRef
  6. Lee EJ, Lee SJ, Bahk HJ, Kim SN, Lee HM. Analysis of carbapenemase-producing Enterobacteriaceae (CPE) surveillance results for 2017 in Korea: comparison with the surveillance results of the previous 5 years (2012-2016). Brief report. Cheongju: KCDC; 2018. p1586-1594.
  7. Hong SK, Yong D, Kim K, Hong SS, Hong SG, Khosbayar TKhosbayar T, et al. First outbreak of KPC-2-producing Klebsiella pneumoniae sequence type 258 in a hospital in South Korea. J Clin Microbiol. 2013;51:3877-3879. https://doi.org/10.1128/JCM.01730-13.
    Pubmed KoreaMed CrossRef
  8. Yoon EJ, Yang JW, Kim JO, Lee H, Lee KJ, Jeong SH. Carbapenemase-producing Enterobacteriaceae in South Korea: a report from the National Laboratory Surveillance System. Future Microbiol. 2018;13:771-783. https://doi.org/10.2217/fmb-2018-0022.
    Pubmed CrossRef
  9. Monaco M, Giani T, Raffone M, Arena F, Garcia-Fernandez A, Pollini SPollini S, et al. Colistin resistance superimposed to endemic carbapenem-resistant Klebsiella pneumoniae: a rapidly evolving problem in Italy, November 2013 to April 2014. Euro Surveill. 2014;19. https://doi.org/10.2807/1560-7917.es2014.19.42.20939.
    Pubmed CrossRef
  10. Tumbarello M, Trecarichi EM, De Rosa FG, Giannella M, Giacobbe DR, Bassetti MBassetti M, et al. Infections caused by KPC-producing Klebsiella pneumoniae: differences in therapy and mortality in a multicentre study. J Antimicrob Chemother. 2015;70:2133-2143. https://doi.org/10.1093/jac/dkv086.
    Pubmed CrossRef
  11. Ahn S, Sung JY, Kim H, Kim MS, Hwang Y, Jong SJong S, et al. Molecular epidemiology and characterization of carbapenemase-producing Enterobacteriaceae isolated at a university hospital in Korea during 4-year period. Ann Clin Microbiol. 2016;19:39-47. https://doi.org/10.5145/ACM.2016.19.2.39.
    CrossRef
  12. Hong JS, Park BY, Kim D, Kim K, Lee KH, Cho NHCho NH, et al. Epide-miological study of an outbreak of KPC-2-producing Klebsiella pneumoniae in a tertiary hospital in Korea. Ann Clin Microbiol. 2020;23:81-92. https://doi.org/10.5145/ACM.2020.23.2.5.
    CrossRef
  13. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, M100-S22. Wayne, PA: Clinical and Laboratory Standards Institute; 2012.
  14. Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70:119-123. https://doi.org/10.1016/j.diagmicrobio.2010.12.002.
    Pubmed CrossRef
  15. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol. 2005;43:4178-4182. https://doi.org/10.1128/JCM.43.8.4178-4182.2005.
    Pubmed KoreaMed CrossRef
  16. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding. Trends Microbiol. 2014;22:686-696. https://doi.org/10.1016/j.tim.2014.09.003.
    Pubmed KoreaMed CrossRef
  17. Yoo JS, Kim HM, Yoo JI, Yang JW, Kim HS, Chung GTChung GT, et al. Detection of clonal KPC-2-producing Klebsiella pneumoniae ST258 in Korea during nationwide surveillance in 2011. J Med Microbiol. 2013;62:1338-1342. https://doi.org/10.1099/jmm.0.059428-0.
    Pubmed CrossRef
  18. Jeong S, Kim JO, Yoon EJ, Bae IK, Lee W, Lee HLee H, et al. Extensively drug-resistant Escherichia coli sequence type 1642 carrying an IncX3 plasmid containing the blaKPC-2 gene associated with transposon Tn4401a. Ann Lab Med. 2018;38:17-22. https://doi.org/10.3343/alm.2018.38.1.17.
    Pubmed KoreaMed CrossRef
  19. Poirel L, Hombrouck-Alet C, Freneaux C, Bernabeu S, Nordmann P. Global spread of New Delhi metallo-β-lactamase 1. Lancet Infect Dis. 2010;10:832. https://doi.org/10.1016/S1473-3099(10)70279-6.
    Pubmed CrossRef
  20. Bonura C, Giuffrè M, Aleo A, Fasciana T, Di Bernardo F, Stampone TStampone T, et al. An update of the evolving epidemic of blaKPC carrying Klebsiella pneumoniae in Sicily, Italy, 2014: emergence of multiple non-ST258 clones. PLoS One. 2015;10. https://doi.org/10.1371/journal.pone.0132936.
    Pubmed KoreaMed CrossRef
  21. Castanheira M, Farrell SE, Wanger A, Rolston KV, Jones RN, Mendes RE. Rapid expansion of KPC-2-producing Klebsiella pneumoniae isolates in two Texas hospitals due to clonal spread of ST258 and ST307 lineages. Microb Drug Resist. 2013;19:295-297. https://doi.org/10.1089/mdr.2012.0238.
    Pubmed CrossRef
  22. Bocanegra-Ibarias P, Garza-González E, Padilla-Orozco M, Mendoza-Olazarán S, Pérez-Alba E, Flores-Treviño SFlores-Treviño S, et al. The successful containment of a hospital outbreak caused by NDM-1-producing Klebsiella pneumoniae ST307 using active surveillance. PLoS One. 2019;14. https://doi.org/10.1371/journal.pone.0209609.
    Pubmed KoreaMed CrossRef
  23. Patil S, Chen H, Guo C, Zhang X, Ren PG, Francisco NMFrancisco NM, et al. Emergence of Klebsiella pneumoniae ST307 co-producing CTX-M with SHV and KPC from paediatric Patients at Shenzhen children's hospital, China. Infect Drug Resist. 2021;14:3581-3588. https://doi.org/10.2147/IDR.S324018.
    Pubmed KoreaMed CrossRef
  24. Wei L, Feng Y, Wen H, Ya H, Qiao F, Zong Z. NDM-5-producing carbapenem-resistant Klebsiella pneumoniae of sequence type 789 emerged as a threat for neonates: a multicentre, genome-based study. Int J Antimicrob Agents. 2022;59. https://doi.org/10.1016/j.ijantimicag.2021.106508.
    Pubmed CrossRef
  25. Gu B, Bi R, Cao X, Qian H, Hu R, Ma P. Clonal dissemination of KPC-2-producing Klebsiella pneumoniae ST11 and ST48 clone among multiple departments in a tertiary teaching hospital in Jiangsu Province, China. Ann Transl Med. 2019;7:716. https://doi.org/10.21037/atm.2019.12.01.
    Pubmed KoreaMed CrossRef
  26. Biedrzycka M, Urbanowicz P, Guzek A, Brisse S, Gniadkowski M, Izdebski R. Dissemination of Klebsiella pneumoniae ST147 NDM-1 in Poland, 2015-19. J Antimicrob Chemother. 2021;76:2538-2545. https://doi.org/10.1093/jac/dkab207.
    Pubmed CrossRef
  27. Rad ZR, Rad ZR, Goudarzi H, Goudarzi M, Alizade H, Mazraeh FNMazraeh FN, et al. Detection of NDM-1 producing Klebsiella pneumoniae ST15 and ST147 in Iran during 2019-2020. Acta Microbiol Immunol Hung. 2021;68:177-182. https://doi.org/10.1556/030.2021.01381.
    Pubmed CrossRef
  28. Gondal AJ, Saleem S, Jahan S, Choudhry N, Yasmin N. Novel carbapenem-resistant Klebsiella pneumoniae ST147 coharboring blaNDM-1, blaOXA-48 and Extended-Spectrum β-Lactamases from Pakistan. Infect Drug Resist. 2020;13:2105-2115. https://doi.org/10.2147/IDR.S251532.
    Pubmed KoreaMed CrossRef
  29. Damjanova I, Tóth A, Pászti J, Hajbel-Vékony G, Jakab M, Berta JBerta J, et al. Expansion and countrywide dissemination of ST11, ST15 and ST147 ciprofloxacin-resistant CTX-M-15-type beta-lactamase-producing Klebsiella pneumoniae epidemic clones in Hungary in 2005-the new 'MRSAs'? J Antimicrob Chemother. 2008;62:978-985. https://doi.org/10.1093/jac/dkn287.
    Pubmed CrossRef
  30. Andrade LN, Vitali L, Gaspar GG, Bellissimo-Rodrigues F, Martinez R, Darini AL. Expansion and evolution of a virulent, extensively drug-resistant (polymyxin B-resistant), QnrS1-, CTX-M-2-, and KPC-2-producing Klebsiella pneumoniae ST11 international high-risk clone. J Clin Microbiol. 2014;52:2530-2535. https://doi.org/10.1128/JCM.00088-14.
    Pubmed KoreaMed CrossRef


Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information
  • Daejeon Institute of Science and Technology