search for   

 

Diagnostic Method for the Detection of JC Polyomavirus Using Loop-mediated Isothermal Amplification
Korean J Clin Lab Sci 2019;51:414-419  
Published on December 31, 2019
Copyright © 2019 Korean Society for Clinical Laboratory Science.

Kyu Bong Cho

Department of Biomedical Laboratory Science, Shinhan University, Uijeongbu, Korea
Correspondence to: * Kyu Bong Cho
Department of Biomedical Laboratory Science, Shinhan University, 95 Hoam-ro, Uijeongbu 11644, Korea
E-mail: kbcho@shinhan.ac.kr
* ORCID: https://orcid.org/0000-0002-2457-7811
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
JC polyomavirus (JCPyV) is a human pathogenic virus belonging to the family Polyomaviridae, a viral group containing dsDNA nucleic acid. A recent recommendation is to apply the presence of JCPyV as a fecal indicator for water contamination in environments like sewage, and techniques to monitor JCPyV in water are being proposed. To date, the conventional PCR system has been applied as a diagnostic method for detecting JCPyV. There is a need for a more rapid and sensitive JCPyV diagnostic detection method in clinical and environmental samples. In this study, we developed a loop-mediated isothermal amplification (LAMP) primer set for the detection of JCPyV. Our results indicate that the LAMP method using a specific primer set shows about 10-fold higher detection sensitivity than the conventional PCR system. The effectiveness of the LAMP method developed in this study has been validated by PCR product digestion using the HaeIII restriction enzyme. We, therefore, propose that the LAMP method using a specific primer set can be applied as a rapid and sensitive detection method for monitoring JCPyV in clinical and environmental samples.
Keywords : Fecal indicator, JCPyV, Loop-mediated isothermal amplification, Validation
서 론

JC polyomavirus (JCPyV)는 구형 이중나선 구조의 DNA 바이러스로, Polyomaviridae, Polyomavirus로 분류된다[1]. JCPyV는 일반적으로 진행성 다초점 백색질 뇌증(progressive multifocal leukoencephalopathy, PML)의 원인 바이러스로 보고되었다. 그러나 PML이 없는 다발성 경화증 환자의 뇌척수액에서 검출되기도 하였으며[2], 정상인의 소변에서 JCPyV가 10∼70% 수준으로 검출되고 있고, 임산부, 노인, 장기이식환자 등의 비뇨기를 통한 배설 빈도가 높게 나타나고 있다는 보고[3, 4]에 따라 하, 폐수를 통한 물 환경에서 JCPyV 전파 가능성에 대한 잠재력을 밝힐 필요성이 시사되었다[5]. 따라서 JCPyV는 하수 등과 같은 수계 환경에서의 사람 분변오염의 지표로 제안되었고, 최근 수계 환경에서 JCPyV가 검출되고 있으며 장 관계 바이러스와의 연관성 등이 보고되면서 물 환경에서도 JCPyV에 대한 모니터링의 필요성이 제기되고 있다[6, 7]. 임상, 환경 등의 시료에서 JCPyV를 검출하는데 활용되는 주요 방법은 중합효소연쇄반응(polymerase chain reaction, PCR)을 기반으로 한 특이적 핵산 증폭법이며[2, 8], 많은 연구에서 개발되고 있는 JCPyV 검출을 위한 conventional PCR 프라이머 조합이 보고되고 있으나[7-13], 임상, 환경 등 넓은 범위의 많은 시료를 대상으로 검출할 수 있는 신속한 모니터링을 위한 방법, 특히 저 농도의 오염이 예상되는 환경 시료에서의 검출을 위한 검출 민감도가 높은 검사법이 필요하다. 한편, 동일 온도에서 병원체를 검출할 수 있는 등온증폭법[loop-mediated isothermal amplification (LAMP)]이 보고되고 있다. LAMP는 helicase 활성으로 변성된 DNA를 Bst. polimerase로 일정한 온도에서 수행되는 ‘auto cyclic strand displacement reaction’ 원리로 작동된다. LAMP는 4개의 primer [2개의 outer 프라이머(F3 및 B3) 및 2개의 inner 프라이머(FIP 및 BIP; 각 프라이머 별 두 개의 위치에 부착)]를 사용하며, 최초 주형 핵산에서 줄기-루프 구조가 형성되는 비 주기적 단계 후 동일한 온도에서 지속적으로 증폭이 일어나는 주기적 단계로 구성된다[14, 15]. Lee 등[16] 기존 보고된 LAMP법은 PCR 기법보다 신속하고 높은 특이성과 좋은 검출 민감도를 가지고 있다고 보고되고 있다. 따라서 본 연구에서는 임상, 환경 등에서 JCPyV를 신속하게 모니터링 하는 기술로 적합 할 것으로 사료되는 특이성이 높은 LAMP 프라이머 조합 선발과 아울러 증폭 결과로 양성 반응을 확정 지을 수 있는 기존의 방법보다 향상된 검출 시스템을 개발하고자 본 연구를 수행하였다.

재료 및 방법

1. LAMP 프라이머 설계 및 주형 핵산 수집

JCPyV의 특이적 핵산에 대한 등온증폭을 위한 프라이머 설계하기 위하여 미국국립생물정보센터(national center for biotechnology information, NCBI)로 부터 JCPyV complete genome (NC_001699.1)의 염기서열을 수집하였으며, 프라이머 explorer를 사용하여 총 3개의 LAMP 프라이머 조합을 구성하였다. 설계한 LAMP 프라이머 조합을 기초로 JCPyV 증폭을 위한 주형 plasmid 제작하였다. NCBI accession NC_001699.1을 5,121 nucleotides (nt)를 기준으로 652~871, 1,957∼2,151 및 4,853∼5,029 부분에 위치한 염기서열 621 nt를 Macrogen (Korea)에 의뢰하여 gene을 합성하였다. JCPyV가 환경에서 장 바이러스와의 연관성이 보고됨에 따라 참고바이러스 플라스미드 10종(Rotavirus A, enteric Adenovirus 41, Hepatitisvirus A, Sapovirus, Enterovirus 71, Astrovirus, Hepatitisvirus E, ParechoV A, Norovirus GII 및 Poliovirus)의 일부 염기서열을 gene 합성하였다.

2. LAMP 프라이머 조합 선발

JCPyV의 특이적 증폭이 가능할 것으로 추정되는 LAMP 프라이머 조합 A, B 및 C를 이용하여 주형 JCPyV plasmid에 대한 특이적 반응을 수행하였다. 이후 특이적 반응이 나타난 LAMP 프라이머 조합을 대상으로 참고 바이러스 핵산 10종에 대한 비 특이적 반응 시험을 수행하였다. 특이적 및 비 특이적 반응결과에 의하여 선발된 LAMP 프라이머 조합 A와 C를 대상으로 검출 민감도 시험을 수행하였다. 검출 민감도 시험은 JCPyV plasmid를 1 ng/µL로 정량 후 10−3 (1 pg/µL)에서 10−7 (100 ag/µL)까지 단계 희석하여 반응에 사용하였다. 한편, 등온증폭을 위한 반응액의 조성은 주형 1 µL, LAMP 프라이머 [F3 및 B3 (10 pmole) 각각 1 µL, FIP 및 BIP (10 pmole) 각각 2 µL], Bst-polymerase (8 unit/µL) 1.5 µL, dNTP (10 mM) 2 µL, 10× buffer 2 µL 및 nucleic acid free water 7.5 µL로 총 20 µL였다. 등온증폭 조건은 95°C에서 10분 반응 후, 최적의 등온조건을 찾기 위하여 60, 62 및 64°C 3개의 온도조건에서 1시간 반응시켰다.

3. JCPyV 시험법 비교

기존에 보고된 JCPyV 검출을 위한 conventional PCR과 비교하기 위하여 이번 연구에서 합성한 JCPyV plasmid를 대상으로 검출이 가능한 조합을 탐색한 결과, 보고된 프라이머를 조합 중 총 10개의 Convertional PCR 프라이머 조합이 탐색되었다(Table 1. 이를 활용하여 LAMP 프라이머 조합과 동일하게 단계 희석한 주형 핵산을 대상으로 검출 민감도를 분석하였으며, PCR 조건은 기존에 보고된 것과 동일하게 반응하였으며[9-13], 1.2% agarose gel에서 30분간 100 volt 전기영동 한 후 gel documentation system (Bio Rad, USA)에서 확인하였다.

Comparison of the sensitivity levels of the LAMP primer sets and the conventional PCR primer sets for JCPyV detection

# Reference primerset Product size (nt) Sensitivity (plasmid conc.) Refs.

Primer name Sequence (5′→3′)
LAMP primerset A A-JCPyV_F3 GCATCCCTTGCTACTGTA 220 10 fg/mL This study
A-JCPyV__B3 GAAAAAGCCCAACTGTTGA
A-JCPyV__FIP CCGGAGCTCCAGTTATTACACAAGTACCTCTGAGGCTAT -
A-JCPyV__BIP ACTGGTGGTAGTGCTATTGCCTTTATGATCCCAGTCAGC
LAMP primerset B B-JCPyV_F3 AAGTACCCAGATGGAACAA 194 ND
B-JCPyV__B3 TGAAGAACTGGAGGAACA
B-JCPyV__FIP ATCTAGGTACGCCTTGTGCTCCAAAGAATGCCACAGT -
B-JCPyV__BIP TCCTGATCCCACCAGAAATGTTTTCTCCTCCTGTTAGTGT
LAMP primerset C C-JCPyV_F3 CTCTTCATCTTGTCTTCGTC 177 1 fg/µL
C-JCPyV__B3 GCTGCAAAAAGCTAAAATGG
C-JCPyV__FIP ATGGGGGAACATTCCTGTCTCAGGGTGGAGTTCTTTG -
C-JCPyV__BIP GCAGACCTATCAAGGCCTAAAAGTGCTGAATAGGGAGG
Ref.01 VP1-1 AATCTCAAGTCATGAACACA 280 10 fg/µL [10]
LT-4 ATITATTAGGCCTTGATAGG [10]
Ref.02 VP1-3 ACAAGGCGTACCTAGATAAG 256 10 fg/µL [10]
LT-4 ATITATTAGGCCTTGATAGG [10]
Ref.03 EP1A TGAATGTTGGGTTCCTGATCCCACC 219 >10 pg/µL [11]
LT-4 ATITATTAGGCCTTGATAGG [10]
Ref.04 JV2For AAGATATTTTGGGACACTAACAGGAGGAGA 179 100 fg/µL [12]
LT-4 ATITATTAGGCCTTGATAGG [10]
Ref.05 VPV-9 TTTTGGGACACTAACAGGAG 174 10 fg/µL [13]
LT-4 ATITATTAGGCCTTGATAGG [10]
Ref.06 VP1-1 AATCTCAAGTCATGAACACA 310 10 fg/µL [10]
T2 TGAATAGGGAGGAATCCATG [14]
Ref.07 VP1-3 ACAAGGCGTACCTAGATAAG 286 10 fg/µL [10]
T2 TGAATAGGGAGGAATCCATG [14]
Ref.08 EP1A TGAATGTTGGGTTCCTGATCCCACC 249 1 pg/µL [11]
T2 TGAATAGGGAGGAATCCATG [14]
Ref.09 JV2For AAGATATTTTGGGACACTAACAGGAGGAGA 210 10 fg/µL [12]
T2 TGAATAGGGAGGAATCCATG [14]
Ref.10 VPV-9 TTTTGGGACACTAACAGGAG 204 10 fg/µL [13]
T2 TGAATAGGGAGGAATCCATG [14]

Abbreviation: ND, no data.



4. 확정 동정 시스템

이번 연구에서 개발한 LAMP 프라이머 조합으로 신속하게 JCPyV를 모니터링 한 후 확정 판정을 위하여 특이적 반응을 재검정 할 수 있는 시스템을 구성하였다. 우선 LAMP outer 프라이머 조합인 F3과 B3을 사용하여 JCPyV에 대한 PCR을 수행하여 특이적 핵산 단편을 증폭하였다. PCR 반응 조건은 F3 및 B3 (10 pmole) 각각 1 µL, HS Taq-polymerase (2.5 unit/ µL, GeneAll, Korea) 0.1 µL, dNTP (10 mM) 2 µL, 10× buffer 2.5 µL 및 멸균증류수 17.4 µL로 총 25 µL를 사용하였으며, PCR 반응은 95°C에서 10분간 초기변성단계를 거쳐 95°C에서 45초간 변성, 55°C에서 1분간 결합, 72°C에서 1분간 신장하는 단계를 35회 반복하였으며 그 후 72°C에서 5분간 최종 신장하였다. PCR결과 증폭된 산물은 제한효소 HaeIII로 37°C에서 2시간 동안 처리한 후 2% agarose gel에서 전기영동 하여 결과를 분석하였다.

결 과

1. LAMP 프라이머 선발

JCPyV 반응이 나타나도록 설계한 3개(A, B 및 C)의 LAMP 프라이머 조합을 대상으로 특이적 반응을 검정하였다. 그 결과 3개의 LAMP 프라이머 조합들에서 모두 60, 62 및 64°C 조건에서 특이적 래더링 반응이 나타났다(Figure 1). 양성 반응이 나타난 3개의 LAMP 프라이머 조합들을 대상으로 참고 바이러스 핵산 10종에 대한 비 특이적 반응 시험 결과, LAMP 프라이머 조합 B에서 Astrovirus 핵산에 대한 반응이 나타났으나, 다른 두 개의 LAMP 프라이머 조합들에서는 비 특이적 반응이 나타나지 않아 JCPyV 검출을 위해 활용할 수 있는 적합한 LAMP 프라이머 조합으로 추정되었다(Figure 2). 또한 더욱 좋은 검출 민감도를 가진 LAMP 프라이머 조합을 선발하기 위해 검출 민감도를 분석한 결과, 조합 A는 10 fg/µL, C는 1 fg/µL까지 검출 민감도가 나타나 LAMP 프라이머 조합 C의 검출 민감도가 A에 비해 10배 높은 민감도의 차이를 나타냈다(Figure 3). 따라서 LAMP 프라이머 조합 C는 JCPyV에 특이적 및 높은 검출감도로 모니터링 하기에 적합한 프라이머 조합으로 선발하였다(Figure 3). 한편, 선발한 LAMP 프라이머 조합 C가 반응할 수 있는 조건은 60, 62 및 64°C에서 모두 동일하였으며, 작동 범위의 안정성을 위해 62°C를 최적 조건으로 선정하였다(data not shown).

Fig. 1.

Specific reactions of the three LAMP primer sets for JCPyV detection.

Abbreviations: Lane M, 100 bp Ladder marker; lane number, condition (temperature, °C) of LAMP reaction; N, negative control.


Fig. 2.

Non-specific reactions of LAMP primer sets for the detecting JCPyV.

Abbreviations: Lane M, 100 bp Ladder marker; lane P, positive control; N, negative control; lane, reference viral plasmid [Aiv-A, Aichivirus-A plasmid (VP3-VP1); RV-A, Rotavirus A cDNA; AdV-41, enteric Adenovirus 41 DNA; HAV, Hepatitisvirus A plasmid (VP2-2B); SV, Sapovirus plasmid (NS7-VP1); EV, Enterovirus 71 cDNA; AstV, Astrovirus plasmid (ORF2); HEV, Hepatitisvirus E plasmid (ORF2); PeV-A, ParechoV A plasmid; NoV, Norovirus GII (ORF1-2); PV, Poliovirus cDNA.


Fig. 3.

Comparison of sensitivity between two LAMP primer sets using the JCPyV plasmid.

Abbreviations: Lane M, 100 bp Ladder marker; lane, diluted rates; N, negative control; dot, selective primer sets.



2. JCPyV 시험법 비교

JCPyV를 검출하기 위한 conventional PCR 및 nested PCR 프라이머 조합들을 기초로 본 연구에서 시험 한 결과, 검출 민감도 이하인 약 10−5수준인 10 fg/µL까지 검출 민감도가 나타났으며, 이번 연구에서 개발한 LAMP 프라이머 조합 C가 PCR 또는 nested PCR 보다 약 10배 이상의 좋은 검출 민감도를 나타내는 것으로 분석되었다(Table 1. 또한 conventional PCR의 반응 시간은 약 125분이 소요가 되었으나, 등온증폭법으로 검출할 경우 70분 정도의 반응 시간이 소요되어 기존 방법에 비해 약 55분 이상 검출시간을 단축할 수 있었다.

3. 확정 동정 시스템

등온증폭 반응의 검정을 위하여 프라이머 설계 시 제한효소 HaeIII (GG/CC)가 반응 할 수 있는 부위를 포함하였다. JCPyV 특이적 LAMP 프라이머로 선발된 조합 C의 outer 프라이머를 사용하여 PCR을 수행하였으며, 약 177 nt 길이의 산물을 증폭하였다. PCR 증폭 산물에서 제한 효소의 사이트를 확인하기 위해 제한효소 HaeIII로 처리한 결과 두 개의 밴드 크기(109 및 68 nt)가 확인되었다(data not shown).

고 찰

본 연구에서는 임상 및 환경 등에서 신속하고 특이성이 높으며 특히 저 농도의 바이러스가 존재하는 환경시료에서 높은 검출 민감도로 JCPyV를 진단할 수 있는 새로운 진단방법을 개발하는데 목적이 있다. 그 동안 JCPyV를 비롯한 수인성 장관계바이러스 등을 검출할 경우 conventional PCR과 nested PCR을 주로 사용하였으나 PCR 기반 검사법의 경우 시간이 오래 걸리는 단점이 있었다. 특히 nested PCR의 경우는 두 단계로 구성된 복잡한 과정으로 인하여 약 10시간 이상의 반응 시간이 소요되며 고가의 전용 장비 또한 필요하다. 그러나 본 연구에서 개발하여 적용하고자 하는 JCPyV 검출용 LAMP 방법은 등온조건하에서 6개의 염기서열영역을 인식하는 4개의 프라이머와 helicase의 기능이 포함된 Bst. DNA polymerase를 사용하기 때문에 별도의 전용 PCR 장비를 사용하지 않고 항온수조나 오븐 등과 같은 등온유지가 가능한 저가의 장비를 사용하여 간단하고 빠르게 목적 염기서열을 증폭시켜 기존의 진단법보다 신속 및 정확한 결과를 얻을 수 있는 장점을 적용하고자, LAMP 프라이머 조합 및 반응을 검정할 수 있는 향상된 시스템을 개발하였다[17]. 한편, Kinoshita 등에서는 임상 뇌척수액 환자에서 JCPyV를 진단 할 수 있는 LAMP 프라이머를 보고하였으며, 시료에서 JCPyV의 검출 민감도는 3,000 copies/mL 이상으로 나타났다[18]. 본 연구에서는 임상뿐 아니라 환경 시료에서 추출한 총 핵산에서도 JCPyV 모니터링이 가능한 검사법 개발을 목적으로 하였다. 수계 환경 등 시료는 임상, 식품, 농림, 축산 등 타 시료에 비해 알 수 없는 PCR 저해물질을 다 수 포함하고 있으므로 분자 진단 시 검출 민감도가 중요하며, 본 연구에서는 1 fg/µL의 결과가 나타났다. 본 연구에서 개발한 등온증폭법이 나타내는 검출 민감도는 이론상 증폭 가능한 부분 1 copy만 있어도 증폭이 되는 좋은 결과로 기존 연구에 비해 우수하지만, 순수한 plasmid 환경에서의 시험이었던 것과, 향후 환경 및 임상시료에서의 활용 등의 검증이 필요하다고 사료된다. 본 연구에서 개발한 JCPyV 특이적 등온증폭 프라이머를 사용하여 진단을 수행하는 방법은, 시료에서 JCPyV를 검출하기 위해서는 총 핵산(total DNA)을 추출한 후 이번 연구에서 개발한 LAMP 프라이머 조합 C로 신속하게 모니터링 하여 전기영동 상 사다리 모양의 래더링 밴드를 확인하면 LAMP 양성 반응으로 추정한다. 추정 시료에서 확정 판정 또는 재 검정이 필요하다면, 양성 반응이 나타난 시료에서 추출한 총 핵산을 사용하여 LAMP outer 프라이머 조합으로 PCR 반응을 수행하며 그 후 제한효소 HaeIII로 처리하면 두 개의 밴드로 나타나 양성확정이 가능하다. 만약 추가 PCR 반응이 없이 등온증폭법 만으로 검사를 수행하고, 반응에 SYBR 또는 hydroxynaphthol blue를 활용하면 결과 판독의 경우 전기영동 과정이 생략될 수 있으므로, 총 핵산 상태에서부터 약 70분 수준으로 반응을 확인할 수 있다. 이 경우 기존 conventional PCR 보다는 약 1시간 이상, nested PCR 보다는 약 4시간 이상 단축할 수 있다. 또한 등온증폭법에 사용되는 프라이머 조합은 총 6개 구역에 특이적으로 반응해야 하므로 기존 PCR 프라이머 보다 더욱 특이적으로 JCPyV만을 검출할 수 있을 것으로 예상된다. 이번 연구는 임상에서 PML 환자 또는 PML이 없는 다발성 경화증 환자의 뇌척수액 및 장기이식환자 등에서 JCPyV의 신속한 진단이 가능할 것으로 보인다. 또한 최근 하수 등 환경에 존재하는 장 관계 바이러스와의 연관성이 보고되고 물 환경의 오염 지표로 부상하는 JCPyV의 모니터링 기술로도 활용이 가능 할 것으로 보인다. 따라서 이번에 개발한 방법은 임상과 환경 등에서 JCPyV의 신속한 진단 및 모니터링을 위한 기술로의 활용성이 기대된다.

요 약

JC polyomavirus (JCPyV)는 viral group I, Polyomaviridae로 분류되는 사람 병원성 바이러스 이다. JCPyV는 최근 하수 등 수질오염 지표로 제안됨에 따라 수질환경에서 모니터링 필요성이 제기되고 있다. 임상 및 환경 시료 중 JCPyV 검출을 위해서 PCR 시스템이 사용되어 왔다. 그러나 신속하고 높은 검출 민감도를 가진 방법의 필요성에 따라 이번 연구에서는 등온증폭 프라이머 조합을 개발하였다. 이번에 개발한 방법은 기존 PCR 시스템에 비해 더욱 신속 및 약 10배 더 높은 검출 민감도를 보여주었다. 또한 본 연구에서 개발한 검출 방법의 재 검정을 위해서 HaeIII 제한효소를 이용한 방법을 함께 고안하였다. 따라서 이번 연구는 임상, 환경 등의 시료에서 JCPyV를 모니터링 하기 위한 방법으로 활용이 기대된다.

Acknowledgements

This work was supported by the Shihan University Research Fund, 2019.

Conflict of interest

None

Author’s information (Position)

Cho KB, Professor.

References
  1. Dias J, Pinto RN, Vieira CB, de Abreu Corrêa A. Detection and quantification of human adenovirus (HAdV), JC polyomavirus (JCPyV) and hepatitis A virus (HAV) in recreational waters of Niterói, Rio de Janeiro, Brazil. Mar Pollut Bull. 2018;133:240-245.
    Pubmed CrossRef
  2. Lacobaeus E, Ryschkewitsch C, Gravell M, Khademi M, Wallstrom E, Olsson T, et al. Analysis of cerebrospinal fluid and cerebrospinal fluid cells from patients with multiple sclerosis for detection of JC virus DNA. Mult Scler. 2009;15:28-35.
    Pubmed KoreaMed CrossRef
  3. Berger JR, Miller CS, Danaher RJ, Doyle K, Simon KJ, Norton E, et al. Distribution and quantity of sites of John cunningham virus persistence in Immunologically healthy patients: correlation with John cunningham virus antibody and urine John cunningham virus DNA. JAMA Neurol. 2017;74:437-444.
    Pubmed CrossRef
  4. Randhawa P, Uhrmacher J, Pasculle W, Vats A, Shapiro R, Eghtsead B, et al. A comparative study of BK and JC virus infections in organ transplant recipients. J Med Virol. 2005;77:238-243.
    Pubmed CrossRef
  5. Fratini M, Di Bonito P, La Rosa G. Oncogenic papillomavirus and polyomavirus in water environments: is there a potential for waterborne transmission?. Food Environ Virol. 2014;6:1-12.
    Pubmed CrossRef
  6. Dang X, Vidal JE, Oliveira AC, Simpson DM, Morgello S, Hecht JH, et al. JC virus granule cell neuronopathy is associated with VP1 C terminus mutants. J Gen Virol. 2012;93(Pt 1):175-183.
    Pubmed KoreaMed CrossRef
  7. Fumian TM, Guimarães FR, Pereira Vaz BJ, da Silva MT, Muylaert FF, Bofill-Mas S, et al. Molecular detection, quantification and characterization of human polyomavirus JC from waste water in Rio De Janeiro, Brazil. J Water Health. 2010;8:438-445.
    Pubmed CrossRef
  8. Bofill-Mas Silvia. polyomavirus [Internet]. Barcelona: GWPP; 2015 [cited 2019 July 16].
    Available from: http://www.waterpathogens.org/book/polyomavirus.
  9. Agostini HT, Ryschkewitsch CF, Stoner GL. Genotype profile of human polyomavirus JC excreted in urine of immunocompetent individuals. J Clin Microbiol. 1996;34:159-164.
    Pubmed
  10. Bofill-Mas S, Girones R. Excretion and transmission of JCV in human populations. J Neurovirol. 2001;7:345-349.
    Pubmed CrossRef
  11. Buckle GJ, Godec MS, Rubi JU, Tornatore C, Major EO, Gibbs CJ Jr, et al. Lack of JC viral genomic sequences in multiple sclerosis brain tissue by polymerase chain reaction. Ann Neurol. 1992;32:829-831.
    Pubmed CrossRef
  12. Bofill-Mas S, Pina S, Girones R. Documenting the epidemiologic patterns of polyomaviruses in human populations by studying their presence in urban sewage. Appl Environ Microbiol. 2000;66:238-245.
    Pubmed KoreaMed CrossRef
  13. Ricciardiello L, Laghi L, Ramamirtham P, Chang CL, Chang DK, Randolph AE, et al. JC virus DNA sequences are frequently present in the human upper and lower gastrointestinal tract. Gastroenterology. 2000;119:1228-1235.
    Pubmed CrossRef
  14. Parida M, Sannarangaiah S, Dash PK, Rao PV, Morita K. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 2008;18:407-21.
    Pubmed CrossRef
  15. Ushikubo H. Principle of LAMP method-a simple and rapid gene amplification method. Uirus. 2004;54:107-112.
    Pubmed CrossRef
  16. Lee S, Kim H, Lee JY, Rho JY. Development of rapid and highly sensitive detection of Bean common mosaic necrosis virus in leguminous crops using loop-mediated isothermal amplification assay. J Virol Methods. 2017;249:117-120.
    Pubmed CrossRef
  17. Lee S, Kim H, Lee JY, Rho JY. Development of a rapid assay for Peach rosette mosaic virus using loop-mediated isothermal amplification. 2016;44:493-496.
    CrossRef
  18. Kinoshita H, Nakamichi K, Lim CK, Takayama-Ito M, Wang L, Iizuka I, Kurane I, Saijo M. A loop-mediated isothermal amplification assay for the detection and quantification of JC polyomavirus in cerebrospinal fluid: a diagnostic and clinical management tool and technique for progressive multifocal leukoencephalopathy. Virol J. 2018;31(5):136.
    Pubmed KoreaMed CrossRef


Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information
  • Shihan University