search for   

 

Effect of Prostaglandin F2 Alpha on E-cadherin, N-cadherin and Cell Adhesion in Ovarian Luteal Theca Cells
Korean J Clin Lab Sci 2019;51:360-369  
Published on September 30, 2019
Copyright © 2019 Korean Society for Clinical Laboratory Science.

Sang-Hee Lee1, Bae Dong Jung2, Seunghyung Lee3

1Discipline of ICT, School of Technology, Environments and Design, University of Tasmania, Hobart, Australia
2College of Veterinary Medicine, Kangwon National University, Chuncheon, Korea
3College of Animal Life Sciences, Kangwon National University, Chuncheon, Korea
Correspondence to: * Seunghyung Lee
College of Animal Life Sciences, Kangwon National University, 1 Gangwondeahak-gil, Chuncheon 24341, Korea
E-mail: s.lee@kangwon.ac.kr
* ORCID: https://orcid.org/0000-0001-5862-3663
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Cadherins are essential transmembrane proteins that promote cell-cell adhesion and maintain the corpus luteum structure in the ovary. This study examined the influence of prostaglandin F2 alpha (PGF2α) on E-cadherin, N-cadherin, and adhesion in luteal theca cells (LTCs). The luteal cells were isolated from the mid-phase corpus luteum, and the LTCs were cultured separately from the luteal heterogeneous cells according to the morphology of the mesenchymal cells and to determine if steroidogenic and endothelial cells of LTCs, 3beta-hydroxysteroid dehydrogenase (3β-HSD), and vascular endothelial growth factor receptor 2 (VEGFR2) mRNA were used. The LTCs were then incubated in the culture medium supplemented with 0.01, 0.1, and 1.0 mM PGF2α for 24 h, and the E-cadherin and N-cadherin proteins in the LTCs were detected by confocal laser scanning microscopy. The results revealed 3β-HSD mRNA expression in the LTC but no VEGF2R mRNA expression. The E-cadherin and N-cadherin proteins of the LTCs were damaged in the 0.01, 0.1, and 1.0 mM PGF2α treatment groups, and the expression of the N-cadherin protein was reduced significantly in 0.01 mM PGF2α compared to the 0 mM PGF2α treatment groups (P<0.05). In addition, the number of attached LTCs were significantly lower in the 0.01 mM PGF2α treatment group than in the 0 mM PGF2α treatment group (P<0.05). In conclusion, PGF2α affected the disruption of cadherin proteins and cell adhesion in LTCs. These results may help better understand the cadherin and adhesion mechanism during corpus luteum regression in the ovary.
Keywords : Adhesion, Corpus luteum, E-cadherin, N-cadherin, Prostaglandin F2 alpha
서 론

황체(corpus luteum, CL)는 일시적인 내분비 기관으로써 임신성립과 유지를 위한 프로게스테론(progesterone, P4)을 합성하며, 발정주기에 따라 생성과 퇴화를 반복한다[1]. 황체의 생성은 luteinizing hormone (LH) 의해 시작되는데, 이 과정동안 혈관생성과 함께 난소세포의 증식, 분화 및 접착과 같은 과정이 활발하게 일어난다[1]. 포유동물 황체는 이형(heterogeneous)세포들로 구성되어 있으며, 과립막(granulosa cells, GCs) 및 협막(theca cells, TCs) 세포 유래의 luteal steroidogenic cells (LSCs)와 혈관상피세포, 주피세포, 섬유아세포, 림프구 및 대식세포를 포함한 면역세포와 같은 luteal non-steroidogenic cells로 구성된다[2]. 따라서 황체를 구성하는 이러한 이형세포들은 tight junction, gap junction, adherens junction 및 desmosomes과 같은 세포-세포 접착(cell-cell junctions)에 의해 유지되고, 정상적인 이형세포들의 상호작용에 의해 황체 조직이 유지된다[3-6]. 따라서 발정주기에 따라 반복적인 증식과 퇴화과정동안 급격하게 변화하는 황체의 형태 유지와 구조적 퇴행의 메커니즘을 이해하기 위해서는 황체세포의 세포-세포 부착에 대한 연구가 필요하다.

일반적으로 황체 내 LSCs는 그 크기에 따라 2가지로 분류되는데, large 및 small LSCs로 분리되며, 각각의 세포는 난소의 GCs 및 TCs로부터 분화된다[7]. 또한 이러한 large 및 small LSCs들은 luteal GCs (LGCs) 및 luteal TCs (LTCs)라고도 불리며, P4를 합성한다는 공통점이 있지만 P4 합성능력 및 세포 특이적 마커들의 발현 차이가 발생하기 때문에 형태학적 특징이 다른 LGCs 및 LTCs에 비교 연구가 활발하게 이루어지고 있다[8-11]. 하지만, 난소 및 황체 기능을 위한 연구는 TCs 및 LTCs에 대한 관심보다는 GCs 및 LGCs에 집중적으로 초점이 맞춰져 있는데, 아마도 이러한 이유는 in vitro 실험에 사용에 용이한 GCs의 세포생리학적 특징과 함께 난소 및 황체에 있어 성선자극호르몬의 활성, estrogen 및 P4 생산의 주요 장소이기 때문이라고 알려져 있다[12].

세포골격(Cytoskeleton)은 모든 세포질 내 존재하고 세포의 형태를 유지하며 물리적인 영향에 의해 세포의 구조를 유지하는 기초적인 역할을 수행할 뿐만 아니라, 세포-세포 및 세포-조직 간 접착에 직접적으로 관여한다[13]. 포유동물 세포의 actin filaments는 원형질막에 위치한 cell adhesion molecules (CAMs)와의 연결에 통해 세포-세포 접착에 관여한다[14]. Actin filament에 의해 유지되는 세포-세포 접착은 adherens junction으로 알려져 있으며, actin filaments 연결된 anchoring plaques를 통해 각 세포-세포 접착에 해당하는 CAMs과 연결되면서 세포 사이의 결합이 성립되게 된다[13]. 또한 황체를 구성하는 LSCs 및 luteal endothelial cells (LECs)에서 발현되는 cadherin의 종류는 다르다고 알려져 있으며, 이러한 특징을 이용하여 adhesion junction에 관여하는 cadherin은 황체세포를 구별하기 위한 마커로 사용되기도 한다[15, 16].

수정란과 자궁사이에 모체인지가 일어나지 않으면, 황체는 퇴화하게 되며, 난소는 새로운 발정주기를 개시하며[1], 이때 prostaglandin F2 alpha (PGF2α)는 황체 내 LSCs와 LECs에 존재하는 G protein-coupled receptor (GPCR)과 작용하여 apoptotic와 관련된 내/외부 세포신호를 활성화시킨다[17-19]. 실제로 PGF2α를 주입한 소의 황체조직과 이러한 호르몬을 처리한 황체세포의 실험을 통해 PGF2α에 의한 황체의 apoptosis에 대한 연구가 활발하게 이루어져 왔다[20, 21]. 이러한 연구에서 공통적으로 확인할 수 있는 점은 퇴행기 황체조직과 염증인자와 함께 PGF2α가 처리된 황체세포에서는 내/외부 apoptosis가 유발되고 이들은 최종적으로 caspase가 활성화되어 세포 또는 조직의 퇴화가 일어난다는 것이다[22]. 이러한 caspase 단백질에 의해 활성화된 apoptosis에 의해 cytoskeleton은 손상되고 결국, adhesion junction는 끊어지게 되며, 황체의 구조적 퇴행이 진행된다고 알려져 있다[23]. 이와 같이 난소의 황체세포에서 PGF2α에 의한 apoptosis의 연구는 주로 cytokines, nitro oxide (NO), leukotriene C4 및 endothelin-1에 관한 것이며[22, 24, 25], PGF2α의 직접적인 영향을 밝히기 위한 adhesion junction 손상은 새로운 방향을 제시해주시고 있다. 또한 조직학적인 측면에서, LTCs는 다른 황체세포 사이에 위치하기 때문에 이형세포들 사이에서 cadherin에 유지되는 adhesion junction에 관여할 것이라 판단하여, 따라서 본 연구는 난소의 LTCs에서 PGF2α에 의한 cadherin 단백질의 변화와 세포부착에 미치는 영향을 조사하였다.

재료 및 방법

1. 난소의 황체협막세포 분리

모든 동물실험과 관련된 절차는 강원대학교 동물윤리위원회의 규정에 의거하여 실험을 진행하였다(KIACUC-09-0139). 황체는 인근 도축장(JEAIL Industry, Hongcheon, Republic of Korea)의 도축된 미경산 한우(평균연령 28.4±1.1개월)로부터 채취하였으며, 채취 즉시 4°C를 유지하며 2시간 이내로 실험실로 운반되었다. LTCs 분리를 위해 배란 12∼15일 이후의 황체를 사용하였다. 황체 조직은 세절한 후 Dulbecco Modified Eagle Medium (DMEM; Sigma, St Louis, MO, USA)에 0.65 mg/mL collagenase A (Thermo Fisher, Waltham, MA, USA), 50 U/mL DNase I (MGmed, Seoul, Republic of Korea) 및 0.1% bovine serum albumin (BSA; Sigma)가 포함된 배양액에서 30°C 상태로 90분간 교반 배양한 뒤, DMEM/Nutrient Mixture F12 (D/F12; Sigma)에 10% fetal bovine serum (FBS; Cellgro, Manassas, VA, USA)이 함유된 용액을 기존 세포 현탁액에 10% (v/v)가 되도록 추가하여 5분 동안 추가적으로 교반 하였다. 이 후 세포 현탁액은 200 및 100 μm pore 크기의 필터를 이용하여 찌꺼기를 거른 뒤 4°C에서 630 G의 조건으로 10분 동안 원심분리한 후 상층액을 제거하였다. 이 후 D/F12에 10% FBS 및 1% penicillin/streptomycin solution (P/S solution; Sigma)이 포함된 용액을 이용하여 4°C에서 각각 440 G 및 330 G의 조건으로 10분동안 2회 원심분리 한 후 Trypan blue solution (Sigma)를 이용하여 세포의 농도를 계산한 뒤 1.0×104 cells/mL가 되도록 배양접시(Nunc, Roskilde, Denmark)에 깔아주었고 D/F12에 10% FBS 및 1% P/S solution가 첨가된 배양액을 이용하여 38.5°C, 5% CO2 조건에서 배양하였다. 24시간 후 형태학적인 특징에 따라 LECs 및 LTCs 세포 군집을 0.25% Trypsin-EDTA (Sigma) 및 cloning cylinders (Thermo Fisher)를 사용하여 세포를 분리 배양하였다[26]. 분리된 LTCs는 24시간 동안 배양한 후 0.1% BSA가 첨가된 PBS (BSA/PBS)를 이용하여 2회 세척한 뒤 phenol-free D/F12 (Sigma)에 0.1% BSA, 1% P/S solution 및 0.01, 0.1 및 1.0 mM PGF2α (Dinoprost; sc-203219, SCBT, Santacruz, CA, USA)가 포함된 배양액을 이용하여 24시간 동안 배양된 후 실험에 이용되었다. PGF2α 최소농도 설정은 황체세포의 퇴화 유도를 위한 PGF2α 단독처리의 연구를 참고하여 수행하였다[24].

2. Quantitative reverse transcription PCR

LECs 및 LTCs의 총 mRNA는 TRIzol (TaKaRa, Shiga, Japan)의 제품 매뉴얼에 따라 추출하였으며, NanoDrop 2000 spectrophotometer (Thermo Scientific)를 이용하여 총 5.0 μg mRNA를 cDNA 합성에 이용하였다. cDNA는 PrimScript 1st strand cDNA synthesis kit (TaKaRa) 활용하여 45°C에서 60 분 후 95°C에서 5분 동안 처리된 뒤, 이 후 합성된 1.0 μL cDNA를 이용하여 -Hydroxysteroid dehydrogenase (-HSD), vascular endothelial growth factor receptor 2 (VEGFR2), E-cadherinN-cadherin mRNA 발현양을 측정하기 위해 각각의 primer 조건에 따라 PCR premix kit (Bioneer, Seoul, Republic of Korea)를 사용하여 PCR을 수행하였다(Table 1). PCR 산물은 ethidium bromide (Sigma)이 함유된 2.0% agarose gel을 이용하여 100 V에서 20분간 전기영동을 실시한 뒤 UV light로 가시화하였으며, ImageJ (National Institutes of Health, Bethesda, Maryland, USA)를 이용하여 발현양을 분석하였다.

Information of primer condition for quantitative reverse transcription PCR

Gene Primer (5′-3′) Product size (bp) Annealing temp. (°C) Cycles Accession No.
3β-HSD Forward: TCCACACCAGCACCATAGAA 704 60 21 BC111203
Reverse: CTCCTTGGTTTTCTGCTTGG
VEGFR2 Forward: AGGAGATGCTCGCCTCCCTTTGA 515 60 30 NM_001110000
Reverse: AGGAGATGCTCGCCTCCCTTTGA
E-cadherin Forward: TGTGACTGTGATGGGATCGT 475 60 30 NM_001002763
Reverse: TAGCAGCTTCGGAACCACTT
N-cadherin Forward: CCTCAAACCAGCCCTACCTG 223 60 30 X53615
Reverse: GCTGTACCGCAGAGAAAGGT
β-actin Forward: GAAGATCTGGCACCACAC 187 60 24 AY141970
Reverse: AGAGGCATACAGGGACAGC


3. 면역형광염색

면역형광염색을 위해 Chamber Slide system (Thermo Fisher)에서 배양되며 PGF2α가 처리된 LTCs (1.0×104 cells/mL)는 0.1% BSA/PBS가 포함된 용액으로 2회 세척한 뒤 0.1% BSA/PBS에 3% paraformaldehyde (Sigma)가 함유된 용액에서 30분간 배양되었고, 0.1% BSA/PBS를 이용하여 2회 세척한 뒤, 0.25% Triton-X (Sigma)가 함유된 0.1% BSA/PBS에서 20분간 배양한 후 2회 세척되었다. 이 후 1% BSA/PBS를 이용해 실온의 환경에서 30분간 배양 후 배양액을 제거한 뒤 0.1% BSA/PBS에 1:100으로 희석된 E-cadherin mouse monoclonal IgG (sc-8426, SCBT) 및 N-cadherin mouse monoclonal IgG (sc-59987, SCBT)를 이용하여 3시간동안 실온에서 배양되었다. 이 후 0.1% BSA/PBS 로 2회 세척 후 0.1% BSA/PBS에 1:400으로 희석된 goat anti-mouse IgG-FITC (Cat. 62-6511, Thermo Fisher)를 이용하여 암실 및 실온에서 1시간 동안 배양하였으며, 이 후 2회 세척 후 300 nM DAPI (Sigma)가 함유된 0.1% BSA/PBS를 이용하여 15분동안 암실에서 배양하였다. 최종적으로 LTCs는 0.1% BSA/PBS를 이용하여 세척한 뒤 세포가 부착 되어있는 슬라이드에 1,4-Diazabicycle[2.2.2]octance (Sigma)를 5.0 μL 첨가한 후 커버 글라스를 덮은 뒤 confocal laser scanning microscope (LSM880, Carl Zeiss, Jena, Germany)를 이용하여 관찰되었다.

4. Western blot

PGF2α가 처리된 LTCs에서의 단백질은 Mammalian protein extraction buffer (Thermo Fisher)를 이용하여 제품의 매뉴얼에 따라 추출한 후 25 μg의 단백질은 SDS-PAGE에 의해 30 V에서 20분 및 100 V에서 90분간 분리되었다. 이 후 polyvinylidene difluoride (PVDF) membrane으로 4°C에서 30 V로 180분간 transfer를 실시한 뒤 1시간 동안 5% skim milk가 첨가된 Tris-buffered saline/0.5% Tween-20 (TBS-T)로 실온에서 60분동안 처리하였다. 이 후 membrane은 1% BSA TBS-T에 1:1,000으로 희석한 E-cadherin mouse monoclonal IgG 및 N-cadherin mouse monoclonal IgG 항체가 함유된 용액에서 4°C에서 overnight 시켰으며, 1:10,000으로 희석된 goat-anti-mouse IgG-HRP (sc-2005, SCBT)를 이용하여 암실에서 1시간 동안 실온에서 반응시켰다. 단백질 가시화를 위하여 ECL kit (Thermo Fisher)를 사용하였으며, EZ-capture (ATTO, Tokyo, Japan)를 사용하여 시각화한 후 ImageJ를 이용하여 발현양을 수치화 하였다.

5. Segmentation 기법을 이용한 세포 수 측정

세포 수 측정을 위해 황체에서 분리된 후 배양된 LTCs를 회수한 후 D/F12에 10% FBS 및 1% P/S solution가 첨가된 배양액을 이용하여 1.0×106 cells/mL의 농도로 38.5°C, 5% CO2 조건에서 LTCs를 24시간 동안 배양하였다. 이 후 0 및 0.01 mM의 PGF2α를 앞선 실험 방법과 같이 처리한 후 DMEM에 0.1% BSA가 첨가된 배양액을 이용하여 2회 세척하였다. 이 후 LTCs 이미지는 광학현미경(TS-100, Nikon, Tokyo, Japan)에 장착된 디지털 카메라(EOS750D, Canon, Tokyo Japan)를 활용하여 수집하였다. LTCs 이미지는 ImageJ를 이용하여 8 bit로 변환한 뒤, 사진의 threshold 수치를 조절하여 세포질 내 핵만 관찰되도록 설정하였다. 이후 ImageJ의 analyze particles 기능을 활용하여, LTCs 이미지 내 세포핵의 픽셀만 인식하도록 범위를 설정한 뒤 측정된 particles들의 개수를 측정하였다. 측정된 particles 개수는 배양접시 내 붙어있는 세포라 판단하였고, LTCs 시료마다 5,000개 이상의 세포를 분석한 후 상대적인 수치로 환산하여 분석되었다.

6. 통계분석

본 실험의 결과는 평균±표준오차로 표현하였으며, 통계프로그램(SAS version 9.3, SAS Inc., Cary, NC, USA)을 이용하여 최소 유의차 검정과 General liner mode (GLM)을 적용하여 Duncan 다중검정에 의하여 P<0.05 수준에서 유의차를 검정하였다.

결 과

1. Steroidogenic 및 endothelial 마커를 이용한 세포 검증

황체로부터 형태학적 특징에 따라 분리된 LECs (Figure 1B) 및 LTCs (Figure 1C)의 steroidogenic 기능을 알아보기 위한 -HSD mRNA와 endothelial 세포 유무를 확인하기 위한 VEGFR2 mRNA 발현결과를 Figure 2에 나타냈다. 그 결과 -HSD mRNA는 LTCs에서만 발현되었으며, VEGFR2 mRNA는 LTCs에서 발현되지 않은 것을 확인하였다.

Fig. 1.

Morphology of luteal granulosa cells (LGCs), luteal endothelial cells (LECs) and luteal theca cells (LTCs) of cows. The LGCs, LECs and LTCs were observed under 200× magnification.


Fig. 2.

Expression of 3β-Hydroxysteroid dehydrogenase (3β-HSD), vascular endothelial growth factor receptor 2 (VEGFR2), E-cadherin and N-cadherin mRNA in luteal endothelial cells (LECs) and luteal theca cells (LTCs) of cows, The 3β-HSD, VEGFR2, E-cadherin and N-cadherin expression (A) of LECs and LTCs were normalized to LECs expression (B). Abbreviations: ND, not detection. *P<0.05, **P<0.01, N=5.



2. LTCs에서 E-cadherinN-cadherin mRNA 발현

LECs 및 LTCs에서 E-cadherinN-cadherin mRNA 발현양을 Figure 2에 나타냈다. E-cadherinN-cadherin mRNA는 LECs 및 LTCs에서 모두 발현(Figure 2A)되었으며, E-cadherin의 경우 LTCs에서 유의적으로(P<0.01) 낮게 발현되었으며, N-cadherin은 LTCs에서 유의적(P<0.05)으로 높게 발현되었다(Figure 2B).

3. LTCs에서 PGF2α에 의한 E-cadherin 단백질의 구조적 변화

PGF2α가 처리된 LTCs의 E-cadherin 발현에 대한 immunofluorescence에 대한 결과는 Figure 3에 나타냈다. PGF2α가 첨가되지 않은 LTCs의 경우 E-cadherin 단백질이 정상적으로 발현되는 것을 확인하였으며(Figure 3A, 3E), 0.01 mM 이상의 PGF2α를 처리하였을 때, E-cadherin 단백질이 뭉치거나 붕괴(Figure 3, yellow arrows)된 것을 확인할 수 있었다(Figure 3B∼D, 3F∼3H). 또한 0.01 mM PGF2α를 처리(Figure 3B, 3F)하였을 때에 비하여 1.0 mM PGF2α 처리(Figure 3D, 3H)하였을 때 E-cadherin이 붕괴되어 응집된 단백질(Figure 3, yellow arrows)을 포함하는 세포들이 증가된 것을 확인하였다.

Fig. 3.

Confocal laser scanning microscope image of E-cadherin protein in prostaglandin f2 alpha (PGF2α) treated bovine luteal theca cells (LTCs). The LTCs were incubated in culture media supplemented 0 mM (A, E), 0.01 mM (B, F), 0.1 mM (C, G), and 1.0 mM (D, H) PGF2α. Green: E-cadherin protein, blue: nucleus, yellow arrows: damaged E-cadherin.



4. LTCs에서 PGF2α에 의한 N-cadherin의 구조적 변화

PGF2α가 처리된 LTCs에서 N-cadherin 발현에 대한 결과를 Figure 4에 나타내었다. PGF2α가 첨가되지 않은 LTCs의 경우 N-cadherin 단백질이 세포 원형질막 주변으로 정상적으로 발현되는 것을 확인하였으며(Figure 4A, 4E), 0.01 mM 이상의 PGF2α를 처리하였을 때, N-cadherin이 뭉치거나 붕괴(Figure 4, yellow arrows)된 것을 확인할 수 있었다(Figure 4B4D, 4F4H). 또한 0.01 mM PGF2α를 처리(Figure 4B, 4F)하였을 때에 비하여 1.0 mM PGF2α 처리(Figure 4D, 4H)하였을 때 N-cadherin이 붕괴되어 응집된 단백질(Figure 4, yellow arrows)을 포함하는 세포들이 증가된 것을 확인하였으며, 0.1 및 0.01 mM PGF2α 처리구에서는 LTCs의 형태가 응축되는 것을 확인하였다(Figure 4G, 4H).

Fig. 4.

Confocal laser scanning microscope image of N-cadherin protein in PGF2αtreated bovine luteal theca cells (LTCs). The LTCs were incubated in culture media supplemented 0 mM (A, E), 0.01 mM (B, F), 0.1 mM (C, G), and 1.0 mM (D, H) PGF2αin 24 h. Green: N-cadherin protein, blue: nucleus, yellow arrows: damaged N-cadherin.



5. LTCs에서 PGF2α에 의한 E-및 N-cadherin의 단백질 발현 변화

PGF2α가 처리된 LTCs에서 E-및 N-cadherin 단백질 발현에 대한 결과를 Figure 5에 나타내었다. E-cadherin 단백질 발현은 0 mM 및 0.01 mM PGF2α 처리군에서 유의적인 차이가 나타나지 않았지만 N-cadherin 단백질은 0.01 mM PGF2α 처리군에서 유의적으로 감소하였다(P<0.05).

Fig. 5.

Influence of prostaglandin f2 alpha (PGF2α) on expression of E- and N-cadherin proteins in luteal theca cells (LTCs) of cows. *P<0.05, N=5.



6. PGF2α가 LTCs 세포 부착에 미치는 영향

PGF2α가 LTCs의 세포부착에 미치는 영향에 대한 결과를 Figure 6에 나타냈다. ImageJ를 이용하여 LTCs의 세포핵의 테두리만 segmentation (Figure 6C, 6D, yellow line)되어 구분된 것을 확인하였으며, 0.01 mM PGF2α에 의해 LTCs의 접착율이 유의적으로(P<0.05) 감소하는 것을 확인하였다(Figure 6E).

Fig. 6.

Comparison of attachment ability in PGF2αtreated bovine luteal theca cells (LTCs). The LTCs were treated with 0 mM (A, C) and 0.01 mM (B, D) PGF2αin 24 h. The attached LTCs were counted by image segmentation methods by ImageJ software (C, D). The number of attached LTCs were normalized to 0 mM treatment group, *P<0.05. N=5.


고 찰

중기 황체조직에 존재하는 LTCs는 LGCs, LECs, 및 다른 세포들 사이에 위치하고 있고, 퇴행기 때에는 PGF2α에 의한 다양한 세포신호에 의하여 이형세포들의 세포-세포 결합이 끊어진 것을 이전 연구를 통해 확인하였다. 결국 급격하게 성장한 황체세포들은 LTCs와의 연결을 통해 세포-세포 결합에 의해 그 구조가 유지되며, 퇴행기의 PGF2α는 세포-세포 결합을 붕괴시킬 수 있는 물질로써 작용할 수 있을 것이다. 따라서 본 연구에서는 난소 내 존재하는 협막세포간의 adhesion junction을 유지시키는 cadherin 인자들의 변화를 관찰하고, PGF2α가 이들의 작용에 관여하는지를 알아보았다.

황체 내에는 형태학적으로 다양한 LSCs와 LECs가 존재한다고 알려져 있으며, 황체세포의 비율은 LTCs가 LGCs보다 많지만 LGCs의 부피가 대략 13배 이상 크다고 알려져 있다[2]. 또한 영장류의 LGCs는 LTCs에 비해 P4의 생산량이 2∼40배 이상 높다고 알려져 있으며[7], LH에 의한 prostaglandin 인자들의 분비는 소의 LTCs와 LGCs에서 구별된다고 보고되었다[8, 9]. 뿐만 아니라 암양으로부터 분리한 LTCs 및 LGCs에 LH와 수용체를 공유하는 human chorionic gonadotropin (hCG)을 처리하였을 때 LGCs의 P4 생산량이 LTCs에 비해 증가하였으며, 소 황체로부터 분리한 이형세포들 중 LGCs가 steroidogenic과 관련된 유전자와 정의 상관관계가 있다고 보고하였다[11]. 이에 따라 황체에서 주요한 역할을 하는 LGCs에 대한 연구는 많이 이루어지고 있으나 LTCs에 대한 연구는 많이 부족한 실정이다[12]. 우리는 황체에서 분리한 이형세포들 중에서 LTCs의 LTCs를 성공적으로 분리하였고, 이전 연구와 같이 LTCs의 형태학적 특징은 LGCs 및 LECs와 구별되는 것을 확인할 수 있었으며, LGCs 및 LECs와는 다르게 mesenchymal 세포에서 관찰되는 형태학적 특징을 관찰할 수 있었다[26]. 특히 LTCs에서 steroidogenesis와 관련된 효소의 mRNA 발현과 LECs에서만 발현되는 유전자가 발현되지 않는 것을 확인하였는데, 이는 LTCs는 혈관세포와는 구별되는 세포이면서, P4를 합성할 수 있다는 능력을 의미한다. 또한 LTCs에서 E-및 N-cadherin mRNA의 연구를 통해 소의 LTCs에는 세포-세포 결합에 관여하는 cadherin이 존재한다는 것을 확인하였고, E-및 N-cadherin의 발현은 LTCs 및 LECs와 서로 다르게 발현되는 것을 확인하였다. 흥미롭게도 mesenchymal 세포의 형태학적 특징을 갖는 LTCs에서도 E-cadherin이 발현된다는 것을 확인하였다.

PGF2α는 황체 조직의 퇴행을 야기시키지만 황체세포의 직접적인 퇴화의 원인은 명확하게 밝혀지지 않고 있다. 몇몇 연구에서는 PGF2α가 LSCs에 직접적으로 영향을 미치는 것보다는 림프구, 대식세포 및 LECs의 TNFα, IFNγ, NO 및 endothelin-1을 활성화시켜 간접적으로 LSCs의 apoptosis를 야기시킨다고 알려져 있다[28]. 일반적으로 10−6 M와 10−5 M PGF2α는 LSCs에서 P4의 생산량을 증가시키고[29], 10−5 M PGF2α는 세포의 이차 전달자(secondary messenger)인 intracellular Ca2+를 증가시키는 것으로 알려져 있다[24]. 흥미롭게도 1.0 μg/mL PGF2α를 24시간동안 LSCs에 처리하면 세포의 사멸에 영양을 미친다고 보고하고 있는데, 이러한 연구들은 단일 PGF2α 처리가 황체세포의 퇴화에 직접적으로 영향을 미치는 결과라 할 수 있겠다. 또한 Korzekwa (2014)는 2.8 μM dinoprost, 2.4 μM cloprostenol 및 2.2 μM luprostiol과 같은 합성 PGF2α를 단독으로 사용하여 황체세포의 생존율 감소와 DNA 절편화 및 capspase-3 활성을 증가시켰다고 보고하고 있다[29]. 따라서 본 연구에서는 steroidogenic 기능을 가지며 황체세포들 사이에 위치한 LTCs에 PGF2α만 단독으로 처리하여 세포-세포 접착 붕괴에 대한 연구를 진행하기 위하여 PGF2α의 최소농도(0.01 mM)를 설정하였다. 일반적으로 황체 퇴화는 PGF2α에 LGCs의 직접적인 손상보다는 면역세포 및 혈관세포에서 분비되는 cytokine 인자들에 의하여 LGCs의 손상을 유도한다고 알려져 있지만 본 연구에서는 PGF2α 단독처리만으로 LTCs에 손상을 주었다[28]. 이러한 결과는 0.01 mM 이상의 PGF2α는 황체 내 면역 및 혈관세포에서 분비되는 TNFα, IFNγ, NO 및 endothelin-1와 같은 steroidogenic 세포 사멸인자의 존재 여부와 상관없이 직접적으로 LTCs를 손상시킬 수 있다고 판단되며, 황체 내 이형세포들 사이에 존재하는 LTCs가 PGF2α에 의해 황체 내 세포들의 세포결합을 감소시킬 수 있음을 시사한다.

난소의 황체세포에서 cadherin molecules은 황체 내 존재하는 혈관세포, LGCs 및 황체세포들에 따라 그 발현이 다르기 때문에 황체 내 세포의 종류를 확인하기 위한 마커로도 이용되고 있다[14]. 실제로 본 연구에서 LTCs와 비교하기 위해 사용된 LECs에서 E-cadherin 및 N-cadherin이 정상적으로 발현되었는데, E-cadherin과 N-cadherin이 LECs에서 발현되는 결과와 일치하는 것을 확인하였다[16]. 또한 퇴행기의 젖소 황체 조직에서는 E-및 N-cadherin이 감소하였으며, PGF2α 주입 후 4시간 후의 N-cadherin이 감소하였지만 구체적으로 황체를 구성하는 세포들에서 PGF2α에 의한 cadherin에 대한 연구는 아직까지 부족한 실정이다[16]. 다만 intermediated filament인 cytokeratin의 발현 양상이 서로 다른 LEC에 따라 E-및 N-cadherin의 함량이 다르다는 것은 보고된 바 있지만 소 황체를 구성하는 이형세포들의 PGF2α에 대한 cadherin에 대한 연구는 명확하게 밝혀지지 않았다[16]. 이에 따라 소 LTCs에서 PGF2α에 따른 cadherin에 대한 결과는 황체 조직 내 이형세포들 사이에 위치하고 있는 LTCs가 세포 사이의 결합에 중요한 역할을 할 수 있을 것임을 시사한다. 추가적으로, 중기난소의 황체에서 분리한 LTCs에서 E-및 N-cadherin에 대한 기존의 연구를 바탕으로 본 연구결과와 비교해보려 하였지만, LTCs에서 cadherin에 대한 연구를 확인할 수 없었다. 본 연구에서는 LTCs에서 cadherin 단백질 발현위치와 PGF2α에 의한 이들 단백질의 붕괴에 대한 연구 결과를 통하여 황체퇴행의 직접적인 원인을 밝혀내기 위해 매우 중요하다고 생각된다. 포유동물의 황체에서 E-cadherin 단백질은 인간황체의 초기 및 중기에 비하여 후기(퇴행기)에서 감소한다고 알려져 있으며, 원숭이의 황체에서는 E-cadherin이 초기에 비하여 중기 및 후기에서 감소한다고 알려져 있다[30]. 또한 배란 이후 황체가 형성되는 동안 쥐 난소에서 N-cadherin 단백질이 증가한다고 알려져 있으며, 면역 형광조직염색을 통해 E-및 N-cadherin이 쥐 황체조직의 세포에서도 정상적으로 발현되는 것을 확인하였다[31]. 그에 반해 소 황체의 경우 E-및 N-cadherin에 대한 조직학 및 특정 세포에서의 발현에 대한 연구가 보고되지 않고 있으며, 이에 따라 본 연구에서는 소 황체로부터 분리한 LTCs에서 이들 단백질의 위치를 검토한 결과 E-및 N-cadherin 단백질이 정상적으로 발현되는 것을 확인하였다. 또한 이들 단백질은 PGF2α가 단독으로 처리된 LTCs에서 불규칙하게 응집되어 발현되는 것을 확인하였으며, 특히 N-cadherin의 단백질 발현이 감소한 것을 확인하였는데, 이는 PGF2α가 세포원형질막에 일정하게 배열된 cadherin 단백질에 부정적인 영향을 미친 것으로 판단된다. 이러한 이유는 cadherin은 세포질에 존재하는 actin filament와 anchoring 단백질인 catenin에 의해 연결되어 있고, 세포 질 내 정상적인 actin filament 분포에 의하여 cadherin이 원형질막 표면에 안정적으로 배열되게 되는데, PGF2α가 처리된 경우 E-및 N-cadherin 단백질이 응집되어 나타나는 현상으로 보았을 때 세포질 내 actin filament의 구조가 붕괴된 것이라 판단된다[32]. 최근 임신한 돼지 황체는 flutamide에 의해 catenin이 감소되며, E-cadherin이 증가된다는 보고가 있지만, 아직까지 황체에서 cadherin에 대한 연구는 부족한 실정이다[33]. 아쉽게도 본 연구에서는 PGF2α에 의한 소 LTCs의 actin filament와 catenin의 변화까지는 관찰하지 못하였지만, cadherin의 핵심 역할인 세포접착이라는 관점에서 관찰하였을 때, PGF2α에 의해 LTCs의 접착이 감소한 것을 확인할 수 있었다[34]. 물론 기존에 널리 알려진 PGF2α에 의한 황체세포들의 apoptotic 신호로부터 야기되는 caspase 단백질이 cadherin 붕괴 및 LTCs에 세포접착 효율 감소의 원인일 수도 있겠지만, 본 연구에서는 LTCs에 PGF2α를 단독으로 처리하여 cadherin 붕괴 및 세포접착 효율을 감소시켰다는 점에 큰 중요성이 있다고 생각한다. 이와 같은 연구를 토대로 LTC에서 apoptotic 신호에 영향을 미치는 직접적인 PGF2α의 영향과 actin filament와 catenin의 세포신호 메커니즘에 대한 연구를 진행할 예정이다. 또한 발정주기 동안 황체에서 다양한 PGF 수용체들에 대한 연구도 이루어지고 있기 때문에 본 연구에서 진행된 결과를 바탕으로 다양한 합성 PGF2α에 의한 LTCs의 세포-세포 접착관련 연구도 진행할 예정이다[35].

종합적으로 본 연구는 PGF2α가 LTC의 cadherin 단백질들과 세포부착에 직접적으로 미치는 영향에 초점을 두고 실험을 실시하였다. 이러한 이유는 난소의 황체 내에서 LTC는 여러 종류의 세포들 사이에 존재하며 세포-세포 결합을 유지하고 있는데, PGF2α에 의한 LTC의 세포-세포 결합의 직접적인 결함으로 인하여 황체의 세포결합 붕괴가 황체퇴행의 구조적 변화의 원인이 첫 작용이라고 판단하였기 때문이다. 그 결과, PGF2α는 LTC의 cadherin 단백질들을 붕괴시켰을 뿐만 아니라 세포부착에도 영향을 미치는 것을 확인하였다. 결론적으로 이러한 결과들은 PGF2α에 의한 직접적인 cadherin 단백질 손상과 세포간 결합이 붕괴되는 원인에 의하여 황체의 구조적 퇴행이 진행되고, 기능적 황체퇴행이 2차적으로 진행된다는 것을 암시하고 있다. 실제로 난소암과 관련하여 cadherin에 대한 연구는 최근에도 활발하게 이루어지고 있으며, 상피 및 간엽세포 유래 난소암 및 세포의 성장은 E-및 N-cadherin과 매우 밀접한 관련이 있음을 보여주고 있으며, cadherin 단백질에 대한 이해는 난소암 치료를 위해 필수적임을 시사하고 있다[36, 37]. 이에 따라 본 결과는 황체퇴행의 새로운 메커니즘과 난소관련 질병의 원인을 명확하게 밝혀내기 위한 자료로 활용될 것이다.

요 약

Cadherin은 원형질막에 존재하며 세포-세포 결합에 관여하며, 황체 구조 유지에 필수적인 단백질이다. 본 연구에서는 prostaglandin F2 alpha (PGF2α)가 황체의 협막세포(luteal theca cells, LTCs)의 E-cadherin, N-cadherin 및 세포-세포 부착에 미치는 영향에 대해서 수행하였다. 황체세포는 소의 황체중기 조직으로부터 분리하였으며, 황체세포 중에서 mesenchymal 세포 형태학적 특성을 가지는 세포만을 분리하여 LTCs로 판단하였다. 이 후 steroidogenic 기능 및 혈관세포 유무를 판단하기 위해 -HSDVEGF2R mRNA 발현을 확인하였으며, E-cadherinN-cadherin mRNA를 사용하여 LTCs 내 cadherin의 존재여부를 판단하였다. 또한 0, 10−5, 10−4 및 10−3 M PGF2α를 24시간 동안 처리하여 LTCs의 E- 및 N-cadherin 단백질을 관찰한 후 세포-세포 접착 실험을 실시하였다. 그 결과, LTCs에서 -HSD mRNA가 발현되었지만, VEGFR2 mRNA는 발현되지 않았으며, E-cadherinN-cadherin mRNA 모두 발현되는 것을 확인하였다. 또한 E- 및 N-cadherin 단백질은 10−5, 10−4 및 10−3 M PGF2α를 처리한 LTCs에서 응집되어 발현되는 것을 확인하였으며, PGF2α에 의해 LTCs의 세포부착 효율이 유의적으로 감소된 것을 확인하였다. 결론적으로 PGF2α는 LTCs의 E- 및 N-cadherin을 붕괴시켜 세포부착을 감소시켰고, 이러한 결과는 황체퇴행의 새로운 원인을 밝혀 내기 위한 cadherin과 세포부착의 역할을 이해하는데 중요한 자료로 활용될 것으로 판단된다.

Acknowledgements

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2018R1D1A3B07048167).

Conflict of interest

None

Author’s information (Position)

Lee SH1, Researcher; Jung BD2, Professor; Lee S3, Professor.

References
  1. Skarzynski D, Piotrowska-Tomala K, Lukasik K, Galvao A, Farberov S, Zalman Y, et al. Growth and regression in bovine corpora lutea:regulation by local survival and death pathways. Reprod Domest Anim. 2013;48:25-37. https://doi.org/10.1111/rda.12203.
    Pubmed CrossRef
  2. O'shea J, Rodgers R, D'occhio M. Cellular composition of the cyclic corpus luteum of the cow. Reproduction. 1989;85:483-487. https://doi.org/10.1530/jrf.0.0850483.
    Pubmed CrossRef
  3. Berisha B, Bridger P, Toth A, Kliem H, Meyer H, Schams D, et al. Expression and localization of gap junctional connexins 26 and 43 in bovine periovulatory follicles and in corpus luteum during different functional stages of oestrous cycle and pregnancy. Reprod Domest Anim. 2009;44:295-302. https://doi.org/10.1111/j.1439-0531.2008.01068.x.
    Pubmed CrossRef
  4. Groten T, Fraser H, Duncan W, Konrad R, Kreienberg R, Wulff C. Cell junctional proteins in the human corpus luteum:changes during the normal cycle and after HCG treatment. Hum Reprod. 2006;21:3096-3102. https://doi.org/10.1093/humrep/del286.
    Pubmed CrossRef
  5. Spanel-Borowski K. Diversity of ultrastructure in different phenotypes of cultured microvessel endothelial cells isolated from bovine corpus luteum. Cell Tissue Res. 1991;266:37-49. https://doi.org/10.1007/bf00678709.
    Pubmed CrossRef
  6. Sundfeldt K, Piontkewitz Y, Billig H, Hedin L. E-cadherin-catenin complex in the rat ovary:cell-specific expression during folliculogenesis and luteal formation. J Reprod Fertil. 2000;118:375-386. https://doi.org/10.1530/jrf.0.1180375.
    Pubmed CrossRef
  7. Stocco C, Telleria C, Gibori G. The molecular control of corpus luteum formation, function, and regression. Endocr Rev. 2007;28:117-149. https://doi.org/10.1007/978-0-387-88186-7_26.
    Pubmed CrossRef
  8. Alila H, Corradino R, Hansel W. A comparison of the effects of cyclooxygenase prostanoids on progresterone production by small and large bovine luteal cells. Prostaglandins. 1988a;36:259-270. https://doi.org/10.1016/0090-6980(88)90312-7.
    Pubmed CrossRef
  9. Alila H, Dowd J, Corradino R, Harris W, Hansel W. Control of progesterone production in small and large bovine luteal cells separated by flow cytometry. Reproduction. 1988b;82:645-655. https://doi.org/10.1530/jrf.0.0820645.
    Pubmed CrossRef
  10. Brannian JD, Stouffer RL, Shiigi SM, Hoyer PB. Isolation of ovine luteal cell subpopulations by flow cytometry. Biol Reprod. 1993;48:495-502. https://doi.org/10.1095/biolreprod48.3.495.
    Pubmed CrossRef
  11. Spitschak M, Vanselow J. Bovine large luteal cells show increasing de novo DNA methylation of the main ovarian CYP19A1 promoter P2. Gen Comp Endocrinol. 2012;178:37-45. https://doi.org/10.1016/j.ygcen.2012.04.001.
    Pubmed CrossRef
  12. Tajima K, Orisaka M, Mori T, Kotsuji F. Ovarian theca cells in follicular function. Reprod Biomed Online. 2007;15:591-609. https://doi.org/10.1016/s1472-6483(10)60392-6.
    Pubmed CrossRef
  13. Herrmann H, Bär H, Kreplak L, Strelkov SV, Aebi U. Intermediate filaments:from cell architecture to nanomechanics. Nat Rev Mol Cell Biol. 2007;8. https://doi.org/10.1038/nrm2197.
    Pubmed CrossRef
  14. Maroni D, Davis JS. TGFB1 disrupts the angiogenic potential of microvascular endothelial cells of the corpus luteum. J Cell Sci. 2011;124:2501-2510. https://doi.org/10.1242/jcs.084558.
    Pubmed KoreaMed CrossRef
  15. Sheetz MP. Cell control by membrane-cytoskeleton adhesion. Nat Rev Mol Cell Biol. 2001;2:392-396. https://doi.org/10. 1093/biolreprod/83.s1.228.
    Pubmed CrossRef
  16. Shirasuna K, Watanabe S, Nagai K, Sasahara K, Shimizu T, Ricken AM, et al. Expression of mRNA for cell adhesion molecules in the bovine corpus luteum during the estrous cycle and PGF2alpha-induced luteolysis. J Reprod Dev. 2007;53:1319-1328. https://doi.org/10.1262/jrd.19082.
    Pubmed CrossRef
  17. Abera A, Sales K, Catalano R, Katz A, Jabbour H. EP2 receptor mediated cAMP release is augmented by PGF2α activation of the FP receptor via the calcium-calmodulin pathway. Cell Signal. 2010;22:71-79. https://doi.org/10.1016/j.cellsig.2009.09.012.
    Pubmed KoreaMed CrossRef
  18. McCracken JA, Custer EE, Lamsa JC. Luteolysis:a neuroendocrine-mediated event. Physiol Rev. 1999;79:263-323. https://doi.org/10.1152/physrev.1999.79.2.263.
    Pubmed CrossRef
  19. Yamagishi-Kimura R, Honjo M, Aihara M. Contribution of prostanoid FP receptor and prostaglandins in transient inflammatory ocular hypertension. Sci Rep. 2018;8. https://doi.org/10.1038/s41598-018-29273-1.
    Pubmed KoreaMed CrossRef
  20. Yadav VK, Sudhagar RR, Medhamurthy R. Apoptosis during spontaneous and prostaglandin F2α-induced luteal regression in the Buffalo Cow (Bubalus bubalis):involvementof mitogen-activated protein kinases. Biol Reprod. 2002;67:752-759. https://doi.org/10.1095/biolreprod.102.004077.
    Pubmed CrossRef
  21. Yadav VK, Lakshmi G, Medhamurthy R. Prostaglandin F2α-mediated activation of apoptotic signaling cascades in the corpus luteum during apoptosis. J Biol Chem. 2005;280:10357-10367. https://doi.org/10.1074/jbc.m409596200.
    Pubmed CrossRef
  22. Okuda K, Sakumoto R. Multiple roles of TNF super family members in corpus luteum function. Reprod Biol Endocrinol. 2003;1. https://doi.org/10.1186/1477-7827-1-95.
    Pubmed KoreaMed CrossRef
  23. Desouza M, Gunning PW, Stehn JR. The actin cytoskeleton as a sensor and mediator of apoptosis. Bioarchitecture. 2012;2:75-87. https://doi.org/10.4161/bioa.20975.
    Pubmed KoreaMed CrossRef
  24. Korzekwa A, Jaroszewski JJ, Bogacki M, Deptula KM, Maslanka TS, Acosta TJ, et al. Effects of prostaglandin F2α and nitric oxide on the secretory function of bovine luteal cells. J Reprod Dev. 2004;50:411-417. https://doi.org/10.1262/jrd.50.411.
    Pubmed CrossRef
  25. Korzekwa A, Jaroszewski J, Woclawek-Potocka I, Bah M, Skarzynski D. Luteolytic effect of prostaglandin F2α on bovine corpus luteum depends on cell composition and contact. Reprod Domest Anim. 2008;43:464-472. https://doi.org/10. 1111/j.1439-0531.2007.00936.x.
    Pubmed CrossRef
  26. Kim M, Lee SH, Lee S, Kim GY. Expression of fas and TNFR1 in the luteal cell types isolated from the ovarian corpus luteum. Biomed Sci Lett. 2019;25:107-112. https://doi.org/10.15616/BSL.2019.25. 1.107.
    CrossRef
  27. Yuan W, Giudice LC. Programmed cell death in human ovary is a function of follicle and corpus luteum status. J Clin Endocrinol Metab. 1997;82:3148-3155. https://doi.org/10.1210/jc.82.9.3148.
    Pubmed CrossRef
  28. Skarzynski DJ, Jaroszewski JJ, Okuda K. Role of tumor necrosis factor-α and nitric oxide in luteolysis in cattle. Domest Anim Endocrinol. 2005;29:340-346. https://doi.org/10.1016/j.domaniend.2005.02.005.
    Pubmed CrossRef
  29. Korzekwa A, Lukasik K, Pilawski W, Piotrowska-Tomala K, Jaroszewski J, Yoshioka S, et al. Influence of prostaglandin F2 analogues on the secretory function of bovine luteal cells and ovarian arterial contractility in vitro. Vet J. 2014;199:131-137. https://doi.org/10.1016/j.tvjl.2013.09.021.
    Pubmed CrossRef
  30. Khan-Dawood FS, Yang J, Ozigi AA, Yusoff Dawood M. Immunocytochemical localization and expression of E-cadherin, β-catenin, and plakoglobin in the baboon (Papio anubis) corpus luteum. Biol Reprod. 1996;55:246-253. https://doi.org/10.1095/biolreprod55.2.246.
    Pubmed CrossRef
  31. Machell N, Farookhi R. E-and N-cadherin expression and distribution during luteinization in the rat ovary. Reproduction. 2003;125:791-800. https://doi.org/10.1530/rep.0.1250791.
    Pubmed CrossRef
  32. Baum B, Georgiou M. Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling. J Cell Biol. 2011;192:907-917. https://doi.org/10.1083/jcb.201009141.
    Pubmed KoreaMed CrossRef
  33. Grzesiak M, Mitan A, Janik ME, Knapczyk-Stwora K, Slomczynska M. Flutamide alters β-catenin expression and distribution, and its interactions with E-cadherin in the porcine corpus luteum of mid-and late pregnancy. Histol Histopathol. 2015;30:1341-1352. https://doi.org/10.1016/j.repbio.2012.11.053.
    Pubmed CrossRef
  34. Mui KL, Chen CS, Assoian RK. The mechanical regulation of integrin-cadherin crosstalk organizes cells, signaling and forces. J Cell Sci. 2016;129:1093-1100. https://doi.org/10.1242/jcs.183699.
    Pubmed KoreaMed CrossRef
  35. Berisha B, Schams D, Rodler D, Sinowatz F, Pfaffl MW. Changes in the expression of prostaglandin family members in bovine corpus luteum during the estrous cycle and pregnancy. Mol Reprod Dev. 2018;7:622-634. https://doi.org/10.1002/mrd.22999.
    Pubmed CrossRef
  36. Po JW, Roohullah A, Lynch D, DeFazio A, Harrison M, Harnett PR, et al. Improved ovarian cancer EMT-CTC isolation by immunomagnetic targeting of epithelial EpCAM and mesenchymal N-cadherin. J Circ Biomarkers. 2018;7:1-10. https://doi.org/10.1177/1849454418782617.
    Pubmed KoreaMed CrossRef
  37. Yi Y, Cheng JC, Klausen C, Leung PCK. Activin A promotes ovarian cancer cell migration by suppressing E-cadherin expression. Exp Cell Res. In pressed. . https://doi.org/10. 1016/j.yexcr.2019.06.016.
    Pubmed CrossRef


Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information