The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 1.

Table. 1.

Oligonucleotides primers used in current study

Genes Sequence (5’-3’) Annealing temperature (℃) Product size (bp) References
Carbapenemase gene primers
blaIMP F: GGAATAGAGTGGCTTAAYTCTC 52 232 [14]
R: GGTTTAAYAAAACAACCACC
blaVIM F: GATGGTGTTTGGTCGCATA 52 390 [14]
R: CGAATGCGCAGCACCAG
blaOXA-48 F: GCGTGGTTAAGGATGAACAC 52 438 [14]
R: CATCAAGTTCAACCCAACCG
blaNDM F: GGTTTGGCGATCTGGTTTTC 52 621 [14]
R: CGGAATGGCTCATCACGATC
blaKPC F: CGTCTAGTTCTGCTGTCTTG 52 798 [14]
R: CTTGTCATCCTTGTTAGGCG
MLST gene primers
rpoB F: GGCGAAATGGCWGAGAACCA 50 501 [15]
R: GAGTCTTCGAAGTTGTAACC
gapA F: TGAAATATGACTCCACTCACGG 60 450 [15]
R: CTTCAGAAGCGGCTTTGATGGCTT
mdh F: CCCAACTCGCTTCAGGTTCAG 50 477 [15]
R: CCGTTTTTCCCCAGCAGCAG
pgi F: GAGAAAAACCTGCCTGTACTGCTGGC 50 432 [15]
R: CGCGCCACGCTTTATAGCGGTTAAT
phoE F: ACCTACCGCAACACCGACTTCTTCGG 50 420 [15]
R: TGATCAGAACTGGTAGGTGAT
infB F: CTCGCTGCTGGACTATATTCG 50 318 [15]
R: CGCTTTCAGCTCAAGAACTTC
tonB F: CTTTATACCTCGGTACATCAGGTT 45 414 [15]
R: ATTCGCCGGCTGRGCRGAGAG

Abbreviation: MLST, multilocus sequence typing.

Korean J Clin Lab Sci 2022;54:265-72 https://doi.org/10.15324/kjcls.2022.54.4.265
© 2022 Korean J Clin Lab Sci