The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 3.

Table. 3.

PCR primers and conditions used in this study

Gene Primer sequence (5’-3’) Annealing temperature (℃) Amplicon (bp) Accession No.
16s rRNA Forward: AGAGTTTGATCMTGGCTCAG 54.7 1504 NR152050
Reverse: TACGGYTACCTTGTTACGACTT
hly1 Forward: TCCTCCGACTAGGAACCAAA 56 522 AAO81463
Reverse: GCCAGCTTCTCGTGCTTATC
hly2 Forward: GAGCAAAAAGCGAGTGAAGG 55 796 AAK33420
Reverse: GCATCTGGAGCATCAAGTCA
hly3 Forward: CGTGGAGTTATGGCTGGTTT 56 301 EEF64743
Reverse: CTTGTGGATCTTCGGGTCTT
fbp Forward: CGGTTCGTTCAGGAAGAACATC 57 181 AB040536
Reverse: CGGTCATTGCCTACTTGCTCAA
pva Forward: AGCTCGCGCCTTTTGAATTTG 57 164 CAJ77223
Reverse: ACGACCTGTTGGATCGACAG
bsh1 Forward: AATACGGGTTAAGTATGGCTGG 53 152 JX120368
Reverse: AGCTAACAGTTCTCTAGCTTC
bsh2 Forward: GGCTTATCCATGGCTGGATTAA 55 791 JX120369
Reverse: GGGATAAAGGAAGCTCTTCACT
folP Forward: GTAAGTCTTCTCGCCCAGG 57 240 AB024530
Reverse: TGCCCGCTCGACCATTATTC
gapC Forward: TATCGGTCGTCTTGCTTTCC 56 225 M64119
Reverse: TCAGCCCAGTTGATGTTAGC
Korean J Clin Lab Sci 2021;53:277-83 https://doi.org/10.15324/kjcls.2021.53.3.277
© 2021 Korean J Clin Lab Sci