The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 1.

Table. 1.

Oligonucleotides primers used in current study

Gene Sequence (5’-3’) Annealing temperature
(°C)
Product size
(bp)
Reference
MLST primers
adk F: ATTCTGCTTGGCGCTCCGGG 54 583 16
R: CCGTCAACTTTCGCGTATTT
fumC F: TCACAGGTCGCCAGCGCTTC 54 806 16
R: GTACGCAGCGAAAAAGATTC
gyrB F: TCGGCGACACGGATGACGGC 60 911 16
R: ATCAGGCCTTCACGCGCATC
icd F: ATGGAAAGTAAAGTAGTTGTTCCGGCACA 54 878 16
R: GGACGCAGCAGGATCTGTT
mdh F: ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 60 932 16
R: TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
purA F: CGCGCTGATGAAAGAGATGA 54 816 16
R: CATACGGTAAGCCACGCAGA
recA F: CGCATTCGCTTTACCCTGACC 58 780 16
R: TCGTCGAAATCTACGGACCGGA
QRDRs sequencing primers
gyrA F: AAATCTGCCCGTGTCGTTGGT 55 344 12
R: GCCATACCTACGGCGATACC
gyrB F: GAAATGACC CGCCGTAAA 55 272 17
R: ACGACCGATACCACAGCC
parC F: CTGAATGCCAGCGCCAAATT 55 168 12
R: GCGAACGATTTCGGATCGTC
parE F: CTGAACTGCTGGCGGAGATG 60 483 17
R: GCGGTGGCAGTGCGACGTAA
PMQR gene detection primers
aac(6’)-Ib-cr F: TTGCGATGCTCTATGAGTGGCTA 55 482 18
R: CTCGAATGCCTGGCGTGTTT
qepA F: TGGTCTACGCCATGGACCTCA 56 1137 19
R: TGAATTCGGACACCGTCTCCG
qnrA F: AGAGGATTTCTCACGCCAGG 54 516 13
R: GCCATACCTACGGCGATACC
qnrB F: GATCGTGAAAGCCAGAAAGG 54 476 13
R: ATGAGCAACGATGCCTGGTA
qnrC F: GGGTTGTACATTTATTGAATC 47 447 13
R: TCCACTTTACGAGGTTCT
qnrD F: CGAGATCAATTTACGGGGAATA 54 582 13
R: AACAAGCTGAAGCGCCTG
qnrS F: GCAAGTTCATTGAACAGGGT 54 428 13
R: TCTAAACCGTCGAGTTCGGCG

Abbreviations: MLST, multilocus sequence typing; QRDRs, quinolone resistance determining regions; PMQR, plasmid mediated quinolone resistance.

Korean J Clin Lab Sci 2021;53:217-24 https://doi.org/10.15324/kjcls.2021.53.3.217
© 2021 Korean J Clin Lab Sci