The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 4.

Table. 4.

Sequences of oligonucleotide primers and probe for the detection of CALR type 1 & 2 mutations

Primer Direction Length Sequence Modification
CARL-F Forward primer 21 bp 5′- TGGTCCTGGTCCTGATGTCGG -3′ -
CARL-R Reverse primer 21 bp 5′ - CCCAAATCCGAACCAGCCTGG -3′ -
CARL-M1 probe Deletion mutant probe 22 bp 5′ - CGAGGAGCAGAGGACAAGGAGG -3′ FAM-BHQ
CARL-M2 probe Insertion mutant probe 25 bp 5’- TTGTCGGAGGAAGATGAGGAGGAAG-3’ TexasRed-BHQ
Korean J Clin Lab Sci 2021;53:41-8 https://doi.org/10.15324/kjcls.2021.53.1.41
© 2021 Korean J Clin Lab Sci