The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 3.

Table. 3.

Sequences of oligonucleotide primers and probe for the detection of MPL W515L mutation

Primer Direction Length Sequence Modification
MPL-F Forward mutant type allele 20 bp 5′- TGGTGACCGCTCTGCATCTA -3′ -
MPL-R Reverse mutant type allele 16 bp 5′ - AGTGTGCAGGAAACTG -3′ -
MPL Probe Probe 18 bp 5’- CTGGGCCTCAGCGCCGTC -3’ Cy5-BHQ
Korean J Clin Lab Sci 2021;53:41-8 https://doi.org/10.15324/kjcls.2021.53.1.41
© 2021 Korean J Clin Lab Sci