The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 2.

Table. 2.

Sequences of oligonucleotide primers and probe for the detection of JAK2 V617F mutation

Primer Direction Length Sequence Modification
JAK2-F Forward 24 bp 5′- CTTTCTTTGAAGCAGCAAGTATGA -3′ -
JAK2-WR Reverse wild type allele 30 bp 5′ -GTAGTTTTACTTACTCTCGTCTCCACATAC -3′ -
JAK2-MR Reverse mutant type allele 30 bp 5′ - GTAGTTTTACTTACTCTCGTCTCCACATAA -3′ -
JAK2 Probe Probe 30 bp 5’-TGAGCAAGCTTTCTCACAAGCATTTGGTTT-3’ Hex-BHQ
Korean J Clin Lab Sci 2021;53:41-8 https://doi.org/10.15324/kjcls.2021.53.1.41
© 2021 Korean J Clin Lab Sci