The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 1.

Table. 1.

The sequences of 2× OneStep RT-nested polymerase chain reaction (PCR) primers and target size for detection of M segment of severe fever with thrombocytopenia syndrome virus

PCR steps Name of PCR primers Sequence (5’-3’) Product size (bp) Accession No.
1st round PCR SFTSV-MF3 GATGAGATGGTCCATGCTGATTCT 560 KF781489
SFTSV-MR2 CTCATGGGGTGGAATGTCCTCAC
2nd round PCR(Nested PCR) SFTSV-NF TAAACTTGTGTCGTGCAGGC 245 KF781513
SFTSV-NR CCCAGCGACATCTCCTTACA
Korean J Clin Lab Sci 2020;52:143-9 https://doi.org/10.15324/kjcls.2020.52.2.143
© 2020 Korean J Clin Lab Sci