The Korean Journal of Clinical Laboratory Science : eISSN 2288-1662 / pISSN 1738-3544

Table. 1.

Table. 1.

Oligonucleotides used in present study for detection of aminoglycoside resistance determinants

Primer Sequence (5′–3′) Gene References
16S ribosomal RNA methyltransferases
armA-F CAAATGGATAAGAATGATGTT armA [9]
armA-R TTATTTCTGAAATCCACT
rmtA-F ATGAGCTTTGACGATGCCCTA rmtA [9]
rmtA-R TCACTTATTCCTTTTTATCATG
rmtB-F ATGAACATCAACGATGCCCT rmtB [9]
rmtB-R CCTTCTGATTGGCTTATCCA
rmtC-F CGAAGAAGTAACAGCCAAAG rmtC [9]
rmtC-R ATCCCAACATCTCTCCCACT
rmtD-F CGGCACGCGATTGGGAAGC rmtD [9]
rmtD-R CGGAAACGATGCGACGAT
rmtE-F ATGAATATTGATGAAATGGTTGC rmtE [9]
rmtE-R TGATTGATTTCCTCCGTTTTTG
rmtF-F GCGATACAGAAAACCGAAGG rmtF [9]
rmtF-R ACCAGTCGGCATAGTGCTTT
Aminoglycoside modifying enzyme gene detection
aac(3′)-Ia-F GACATAAGCCTGTTCGGTT aac(3′)-Ia [10]
aac(3′)-Ia-R TCCGAACTCACGACCGA
aac(3′)-II-F ATGCATACGCGGAAGGC aac(3′)-II [10]
aac(3′)-II-R TGCTGGCACGATCGGAG
aac(3′)-Ih-F TGCCGATATCTGAATC aac(3′)-Ih [10]
aac(3′)-Ih-R ACACCACACGTTCAG
aph(3′)-VI-F CGGAAACAGCGTTTTAGA aph(3′)-VI [10]
aph(3′)-VI-R TTCCTTTTGTCAGGTC
ant(2″)-Ia-F ATCTGCCGCTCTGGAT ant(3″)-Ia [10]
ant(2″)-Ia-R CGAGCCTGTAGGACT
aph(3′)-Ia-F CGAGCATCAAATGAAACTGC aph(3′)-Ia [10]
aph(3′)-Ia-R GCGTTGCCAATGATGTTACAG
aac(6′)-Ib-F TATGAGTGGCTAAATCGAT aac(3′)-Ib [10]
aac(6′)-Ib-R CCCGCTTTCTCGTAGCA

Abbreviations: F, forward (sense) primer; R, reverse (antisense) primer.

Korean J Clin Lab Sci 2020;52:136-42 https://doi.org/10.15324/kjcls.2020.52.2.136
© 2020 Korean J Clin Lab Sci